Accesando a

https://www.ncbi.nlm.nih.gov 

National Center biotechnology information

MN988713.1 es el identificador para SARS COVID-19
MG772933.1 es el identificador para Bat SARS-like coronavirus isolate bat-SL-CoVZC45

Uso curl para traerme los datos del genoma.

$ curl -s ‘https://www.ncbi.nlm.nih.gov/sviewer/viewer.cgi?report=fasta&id=MG772933.1’
>MG772933.1 Bat SARS-like coronavirus isolate bat-SL-CoVZC45, complete genome
ATATTAGGTTTTTACCTTCCCAGGTAACAAACCAACTAACTCTCGATCTCTTGTAGATCTGTTCTCTAAA
CGAACTTTAAAATCTGTGTGACTGTCACTTAGCTGCATGCTTAGTGCACTCACGCAGTTTAATTATAATT
AATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGTTGCTTACGGTTTCGTCCGTGT
TGCAGCCGATCATCAGCATACCTTGGTTTCGTCCGGGTGTGACCGAGAGGTAAGATGGAGAGCCTTGTCC
CTGGTTTCAACGAGAAAACACACGGTCCACTCAGTTTGCCTGTTTTACAGGTTCGTGACGTGCTTGTACG
TGGCTTTGGAGACTCCGTAGAGGAAGCTTTATCAGAGGCACGTCAACATCTTAAAGATGGCACTTGTGGC
TTAGTAGAAGTTGAAAAAGGTGTTTTACCTCAACTTGAACAGCCCTATGTGTTCATCAAACGTTCTGATG
CCCGAACTGCACCTCACGGCCATGTTATGGTCGAATTAGTAGCAGAACTCGATGGCATTCAGTATGGTCG
TAGTGGTGAGACACTTGGTGTTCTTGTCCCTCATGTAGGAGAGGTACCAGTTGCTTACCGTAAAGTTCTT
CTTCGTAAGAACGGTAATAAAGGAGCTGGTGGCCATAGTTACGGCGCCGATCTAAAGTCTTTTGACTTAG
GCGACGAGCTTGGTACTGATCCTATTGAAGATTTTCAAGAAAATTGGAACACTAAACATGGCAGTGGTGT
TACCCGTGAACTCAAGCGTGAGCTTAACGGAGGTGCATACACTCGCTATGTAGACAACAACTTTTGTGGC
CCAGATGGCTACCCTCTTGAGTGCATTAAAGACCTTCTGGCTCGTGCTGGTAAGGCTTCTTATGCTTTGT
CTGAACAATTGGATTTTATTGACACTAAGAGAGGTGTGTACTGCTGCCGTGAACACGAGCATGAAATTGC
TTGGTACACGGAACGCTCTGAAAAGAGCTATGAATTGCAGACACCTTTTGAAATTAAGTTGGCAAAGAAA
TTTGACACCTTCAATGGGGAATGTCCAAATTTTGTATTTCCTCTAAATTCAACAATCAAGACCATTCAAC
CAAGGGTTGAAAAGAAAAAGCTTGATGGTTTCATGGGTAGAATTCGATCTGTCTATCCTGTTGCTTCACC
AAATGAATGCAACCAAATGTGCCTCTCAATTCTCATGAAGTGTGACCATTGTGGTGAAACTTCATGGCAG
ACGGGTGATTTTGTTAGAGCCACTTGCGAATTCTGTGGTACTGAAAATTTGACTAAAGAAGGTGCCACAA
CTTGTGGTTACTTACCTCAAAATGCTGTTGTAAAACTTTATTGTCCAGCATGTCATAATCCAGAAGTAGG
ACCTGAGCATAGTCTTGCTGAATATCATAATGAGTCTGGTTTGAAAACCGTTCTTCGTAAGGGTGGTCGT
ACCATTGCTTATGGGGGCTGTGTGTTTGCTTATGTTGGTTGCTACAACAAGTGTGCCTATTGGGTTCCAC
GTGCTAGTGCTAACATAGGCTGTAATCACACAGGTGTTGTTGGAGAAGGTTCTGAAAGTCTAAACGACAA
CCTTCTTGAAATATTGCAAAAGGAGAAAGTCAACATCAATATTGTTGGTGACTTTAAACTTAATGAAGAG
ATTGCCATTATTTTGGCATCTTTTTCTGCCTCTATAAGTGCTTTTGTAGAAACTGTAAAAGGTTTGGATT
ACAAAACATTCAAACAAATTGTTGAATCCTGTGGTAACTTTAAAGTTACGAAGGGAAAAGCAAAGAAAGG
TGCCTGGAACATAGGTGAACAAAGTTCAATACTGAGTCCGCTCTATGCGTTCCCTTCAGATGCTGCTCAT
GTTGTACGGTCTATCTTCTCACGCACACTAGAAACTGCTCACCATTCTGTGCATGTCTTACAAAAGGCTG
CTATAATTATCTTAGATGGAATTTCACAGTATTCATTGAGACTCATTGATGCTATGATGTTCACATCTGA
TTTGGTTACTAACAATCTAGTTGTAATGGCTTACATTACGGGTGGTGTTGTACAAATGACTTCACAGTGG
CTAACAAATATCTTTGGCACTGTTTATGAAAAACTTAAACCGGTTCTTGATTGGCTCGAAGAGAAATTCA
AAGAAGGTATAGAGTTTCTTAGAGACGGTTGGGAAATTGTTAAATTTATCTCAACTTGTGCTTGTGAAAT
AGTCGGTGGACAAATTGTCACCTGTGCAAAGGAAATTAAGGAGAGTGTTCAGACATTCTTTAAGCTCGTA
AATAAATTTTTGGCTTTGTGTGCTGACTCCATCATTATTGGTGGAGCTAAACTTAAAGCCTTGAATTTAG
GTGAAACATTTGTCACACACTCAAAGGGATTGTACAGAAAGTGTGTTAGATCCAGAGAAGAAACTGGCTT
ACTCTTGCCTCTGAAAGCTCCAAAAGAAATTATTTTCTTAGAGGGAGAAACACTTCCCACAGAAGTGTTA
ACAGAGGAAGTTGTCTTGAAAACTGGTGTTTTACAACCATTAGAACAACCTACTAATGAGGCTGTTGAAG
CTCCATTGATTGGTACACCAGTCTGTATTAACGGGCTCATGTTGCTCGAAATTAAAGACACAGAAAAGTA
CTGTGCCCTTGCACCTAATATGATGGTAACAAATAATACCTTCACACTTAAAGGTGGTGCACCAACAAAA
GTCACTTTTGGTGATGACACTGTGATTGAAGTGCAGGGTTACAAGAGTGTAAACATCACTTTTGAACTTG
ATGAAAGGATTGATAAAGTACTTAATGAGAAGTGCTCTAATTACACAGTTGAACTCGGTACAGAGGTAAA
CGAGTTCGCTTGTGTTGTTGCTGATGCTGTCATAAAAACTTTACAACCAGTATCTGAACTAATCATACCA
CTGGGCATTGATTTAGACGAGTGGAGTATGGCTACATACTACTTGTTTGATGAGTCCGGTGAATTTAAAT
TGTCTTCACATATGTACTGTTCTTTCTACCCTCCTGAAGATGAAGGGGAAGATGATTGTGAAGAAGGACA
GTGTGAACCATCAACTCAATATGAGTATGGTACTGAGGATGACTACCAAGGTAAACCTTTGGAGTTTGGT
GCTACTTCTTTTTCTTCTTCTTCACAGGAAGAAGAACAAGAAGAGGATTGGTTAGAATCTGATAGTCAGG
ACGGCCAAGAGACTGCAGTTGAAGAAAATAAAATACCGAGTGTTGAAGTTCCACCTGTTTTGCAGGTGGA
ATCAACACCAGTTGTTACTGAAACTAGTGAACAAAATAATTTCACAGGTTATTTAAAATTAACTGACAAT
GTCTTCATTAAAAATGCTGACATTGTAGAAGAAGCTAAAAAGGTAAAGCCTACAGTAGTTGTTAATGCAG
CTAATGTTTACCTTAAACATGGAGGAGGTGTTGCTGGAGCTTTAAATAAGGCAACTAACAACGCCATGCA
GGTTGAATCTGATAAGTACATAACTACCAATGGGCCACTAATTGTGGGTGGTGGTTGTGTTTTGAGTGGA
CATAACCTTGCTAAAAATTGTCTTCATGTTGTTGGCCCTAATGTCAACAGAGGTGAAGACATTCAATTGC
TTAAAAATGCTTATGAAAATTTCAATCAACATGAGATTTTACTCGCACCATTATTATCAGCTGGTATTTT
TGGTGCTGATCCTGTACATTCTTTAAGAGTTTGTGTAGAAACTGTTCACACAAATGTCTATCTAGTTGTC
TTTGACAAAAATCTCTATGACAAACTTGTTTCAAGCTTTTTAGAGATGAAGAGTGAAAAACAAGTAGAAC
AAAAAGTTGCTGAAAATCCTAAAGAGGAAGTTAAGCCATTTTTTACTGAAAATAAACCTTCAGTTGAACA
AAGACAACAAGCTGAAGAGAAGAAAATCAAAGCCAGTATTGAAGAAGTTACAACTACTCTAGAGGAGACC
AAGTTCCTTACAGAAAACTTGTTACTTTATATTGACATCAATGGCAATCTTCACCCAGATTCTGCCACTC
TTGTTAAAGATATTGACACCACTTTCTTGAAGAAAGATGTTCCATATATAGTGGGTGATGTTATTAAAGA
AGGCGCTTTAACTGCTGTAGTTATACCTACTAAAAAGGCTGGTGGCACTACCGAAATGCTTGCTAAAGCT
TTAAGAAAAGTGCCAACAGATAATTATATAACCACCTACCCTGGTCAGGGTTTAAATGGTTACACTGTAG
AAGAAGCAAAGACAGTGCTTAAAAAGTGTAAAAGTGCTTTTTACATTTTACCATCTATTATCTCTAATGC
GAAGCAAGAAATTCTAGGAACTGTTTCTTGGAACTTGCGAGAGATGCTCGCACATGCAGAAGAAACACGT
AAGTTAATGCCTGTTTGTATGGAGACTAAAGCTATAGTTTCAACTATACAACGTAAGTACAAAGGCATTA
AAATACAGGAGGGTGTGGTTGATTATGGTGCTAGATTTTACTTTTACACTAGTAAAACTACTGTAGCATC
ACTTATTAACACACTTAACAATCTAAATGAGACTCTTGTCACAATGCCATTAGGATATGTGACGCACGGT
CTAAATTTAGAAGAAGCTGCTCGGTACATGAGGTCTCTCAAAGTACCGGCTACAGTCTCTGTTTCTTCAC
CAGATGCTGTTACAGCATATAATGGTTATCTTACTTCTTCTTCAAAAACACCTGAAGAACACTTTATTGA
AACCGTTTCACTTGCTGGTTCCTATAAAGATTGGTCTTATTCTGGACAGTCTACACAACTAGGCATAGAA
TTTCTTAAGAGAGGTGATAAGAGTGTATATTACACCAGTAATCCCACTACATTTCACCTAGATGGTGAAA
CTATCACCTTTGATAATCTTAAGACACTTCTCTCTTTGAGAGAAGTGAGGAATATTAAAGTGTTTACAAC
AGTAGACAACATTAACCTCCACACGCAAGTTGTGGATATGTCTATGACATATGGACAACAGTTCGGTCCA
ATTTATTTGGATGGAGCTGATGTTACTAAAATAAAACCTCACAATTCACATGAAGGTAAAACATTTTATG
TTTTGCCTAATGATGATACCTTACGTGCAGAGGCTTTTGAGTACTACCATACAACTGATCCTAGTTTTCT
GGGTAGGTACATGTCAGCTTTAAACCACACTAAAAAGTGGAAATACCCACAAGTAAATGGTTTAACTTCT
ATAAAATGGGCAGATAACAATTGTTATCTTGCTACTGCATTGTTAACAATCCAACAAATAGAGTTGAAAT
TTAATCCACCAGCTTTACAAGACGCCTATTATAGGGCAAGAGCTGGTGAGGCTGCTAATTTTTGTGCACT
TATCCTGGCCTATTGTAATAAGACAGTAGGTGAGTTAGGTGATGTCAGAGAAACAATGAATTATTTGTTT
CAACATGCCAATTTAGATTCTTGTAAAAGAGTCTTGAATGTGGTGTGTAAAACTTGTGGACAACAGCAAA
CAACTCTCAAGGGTGTAGAAGCTGTTATGTATATGGGCACACTTTCTTATGAACAACTTAAGAAGGGTGT
GCAGATACCTTGTATGTGTGGTAAACAAGCTACACAATATCTGGTACAACAAGAGTCACCTTTTGTTATG
ATGTCTGCACCGCCCGCCCAATATGAACTTAAGCATGGTACATTTGTTTGTGCTAGTGAGTATACTGGTA
ATTACCAGTGTGGTCACTACAAACATATAACTTCTAAAGAAACCTTGTATTGCATAGATGGCGCTTTACT
TACAAAGTCCTCTGAGTATAAAGGTTCTATTACAGATGTTTTCTATAAAGAAAACAGTTATACAACAACC
ATAAAACCAGTTACATACAAGTTGGATGGTGTTGTTTGTACAGAAATTGATCCTAAGTTGGATGGTTATT
ATAAGAAAGATAATTCTTATTTCACAGAGCAACCAATTGATCTTGTACCAAACCAACCTTACCCGAATGC
AAGCTTTGACAATTTTAAGTTTGTATGTGATAATACCAAATTTGCCGATGATTTAAATCAATTGTCTGGT
TATAAGAAACCTGCCTCGAGAGAGCTTAAGGTTACATTCTTTCCTGACTTAAATGGTGATGTAGTGGCTA
TTGATTATAAGCACTACACACCTTCTTTTAAGAAAGGAGCTAAATTGCTGCATAAGCCAATTGTTTGGCA
TGTTAACAATGCAACTAACAAAGCAACGTACAAACCAAATATTTGGTGCATACGTTGTCTTTGGAGTACA
AAACCGGTTGAAACATCAAATTCTTTTGATGCACTGGAATTAGGGGACACACAGGGAATGGATAATCTTG
CCTGTGAAGTTCTAAAACCAGTCTCTGAAGAAGTAGTGGAAAATCCTACCATACAGAAAGACATTCTTGA
GTGTAATGTGAAAACTACCGAAGTTGTAGGAGACATTATACTTAAACCGGCAAGTGATGGTCTAAAAATT
ACAAAAGAGGTTGGTCATACAGACCTAATGGCTGCTTATGTTGACAATTCAAGTCTTACTATTAAGAAAC
CTAATGAATTATCCAGAGTATTAGGTTTGAAAACTTTAGCCACTCATGGCTTGGCTGCTATTAATAGTGT
TCCTTGGGACACTATAGCTAATTATGTTAAGCCTTTCCTTAATAAGGTTGTTAGCACAACTACTAACATA
GTTACACGGTGTCTAAACCGTGTTTGTACTAATTATATGCCTTATTTGTTTACTTTATTGCTACAATTGT
GTACTTTTACTAAAAGTACAAATTCTAGAATAAGAGCATCTATGCCAACCACTATAGCAAAGAATACTGT
TAAAAGTGTTGGTAAATTTTGTATAGAGGCTTCATTTAATTATTTGAAGTCACCTAATTTTTCTAAATTG
ATAAATATTGTAATTTGGTTTTTATTATTAAGTGTTTGCCTAGGTTCTTTAATCTATTCAACTGCTGCTT
TAGGTGTCTTAATGTCTAATTTAGGCATGCCTTCTTATTGTACTGTTTACAGAGAAGGTTATTTGAACTC
TACTAATGTCACTACTGCAACCTACTGCACTGGTTCTATACCTTGTAGTGTTTGTCTTAGTGGTTTAGAT
TCTTTGGATACTTACCCATCCTTAGAAACTATACAAATTACCATTTCGTCTTTTAAATGGGATTTAACTG
CTTTTGGTCTAGTTGCAGAGTGGTTTTTGGCATATATTCTTTTTACTAGGTTCTTTTATGTACTTGGATT
GGCTGCAATCATGCAATTGTTTTTCAGCTATTTTGCAGTACATTTTATTAGTAATTCTTGGCTTATGTGG
TTAATAATTAATCTTGTACAAATGGCCCCAATTTCAGCTATGGTTAGAATGTATATTTTCTTTGCATCAT
TTTATTATGTATGGAAAAGTTATGTGCATGTTGTAGATGGTTGTACTTCATCAACTTGTATGATGTGTTA
TAAACGTAATAGAGCAACAAGAGTTGAATGTACAACTATTGTTAATGGTGTTAGAAGGTCCTTTTATGTC
TATGCTAATGGAGGTAAAGGCTTTTGCAAACTACATAACTGGAATTGTATTAATTGTGATACATTCTGTG
CTGGTAGTACATTTATTAGTGACGAAGTTGCTAGAGACTTATCACTACAGTTTAAAAGACCAATAAATCC
TACTGACCAGTCTTCCTATATTGTTGATAGTGTTACAGTGAAGAATGGTTCCATCCATCTTTACTTTGAT
AAGGCTGGTCAAAAGACTTATGAAAGACATTCTCTCTCTCATTTTGTTAACTTAGACAATCTGAGAGCTA
ATAACACTAAGGGTTCATTGCCTATTAATGTTATAGTTTTTGATGGTAAATCAAAATGTGAAGAATCATC
TGCTAAATCAGCGTCTGTTTATTATAGTCAGCTTATGTGTCAACCTATACTGTTACTGGACCAGGCATTA
GTGTCTGATGTTGGTGACAGTGCAGAAGTTGCAGTTAAGATGTTTGATGCTTATGTTAATATATTTTCAT
CAACTTTCAATGTTCCAATGGAAAAACTCAAAGCATTAGTTGCGACTGCAGAAGCTGAACTTGCAAAGAA
TGTGTCTTTAGACAACGTCTTATCTACTTTTATTTCAGCAGCTCGTCAAGGGTTTGTTGATTCAGATGTA
GAAACTAAAGATGTTGTTGAATGTCTTAAATTGTCACACCAATCTGACATAGAAGTTACAGGTGACAGTT
GTAACAATTACATGCTCACTTATAACAAAGTTGAAAACATGACACCTCGGGATCTTGGTGCTTGTATTGA
TTGTAGTGCACGTCATATCAATGCACAGGTGGCAAAAAGTCATAACATAGCTTTGATTTGGAATGTTAAA
GATTTCATGTCATTGTCTGAACAACTACGAAAACAAATACGCAGTGCTGCTAAGAAGAATAACTTGCCTT
TTAGATTGACATGTGCAACCACTAGACAAGTTGTTAATGTTGTTACAACAAAAATAGCACTTAAGGGTGG
TAAAATTGTTAACAACTGGTTGAAGCAGCTGATTAAGGTTACACTTGTGTTTCTTTTCATCACTGTTATC
TTCTATTTAATAACACCTGTTCATGTCATGTTTAAACACAATGACTTTTCAAGTGAAATTATAGGATACA
AGGCTATTGATGGTGGTGTCACTCGTGACATAGCGTCAACAGATACTTGTTTTGCTAACAAACATGCTGA
CTTTGACTCTTGGTTTAGTCAGCGCGGTGGTAGTTATACTAATGATAAAGCTTGCCCATTGGTAGCAGCT
GTTATCACAAGGGAAGTTGGCTTTGTTGTGCCCGGTTTGCCTGGCACAATATTACGCACAATTAATGGTG
ATTTTTTGCATTTTCTTCCTAGAGTGTTTAGTGCGGTAGGTAACATTTGTTACACTCCTTCTAAACTTAT
AGAGTACACTGACTTTGCAACATCGGCATGCGTTTTAGCTGCTGAATGTACCATTTTTAAAGATGCTTCT
GGTAAACCAGTACCTTATTGTTATGATACTAATGTACTAGAAGGTTCTGTTGCGTATGAAAGTCTCCGCC
CTGACACACGCTATGTGCTCATGGACGGTTCTATAATTCAATTCCCTAACACTTACCTTGAAGGTTCTGT
TAGAGTAGTAACAACTTTTGATTCAGAGTATTGTAGACATGGTACTTGCGAAAGATCAGAGGCTGGCATT
TGTGTATCTACTAGTGGTAGATGGGTACTTAATAATGATTATTACAGATCCTTGCCAGGAGTTTTTTGTG
GTGTAGATGCTGTGAATTTACTTACTAATATGTTCACGCCATTAATTCAACCTATTGGTGCTTTGGACAT
ATCTGCATCTATTGTAGCAGGTGGTGTTGTAGCTATTATAGTAACTTGTCTAGCCTACTACTTCATGAGG
TTTAGAAGAGCTTTTGGTGAATACAGTCATGTAGTTGCCTTTAACACTCTACTATTCTTTATGTCATTCA
CTGTACTCTGTTTAACACCAGTCTATTCATTCTTACCTGGTGTTTATTCTGTTATTTACTTGTACTTGAC
ATTTTATCTTACTAATGATGTTTCTTTCTTAGCACATATCCAATGGATGGTTATGTTCACACCCTTAGTG
CCTTTCTGGATGACAATTGTTTATGTCATTTGCATTTCCACAAAGCATTTTTATTGGTTCTTTAGTAACT
ACCTAAAGAGACGTGTAGTCTTTAATGGTGTTTCCTTTAGTACATTTGAGGAGGCTGCATTATGTACCTT
TTTGTTAAATAAAGAAATGTATCTGAAATTGCGTAGTGATGTACTTCTACCTCTTACGCAATACAATAGA
TATTTAGCTCTTTATAATAAGTACAAGTATTTTAGTGGGGCCATGGACACTACCAGTTATAGAGAAGCAG
CTTGCTGTCATCTGGCTAAGGCTATAAATGATTTCAGTAATTCAGGTTCTGATGTCCTCTACCAACCACC
ACAAACTTCAATCACATCAGCGGTTTTGCAGAGTGGTTTTAGAAAAATGGCATTCCCATCTGGTAAAGTT
GAAGGTTGCATGGTACAAGTTACTTGTGGTACCACTACACTTAATGGTCTTTGGCTTGATGATGTAGTTT
ACTGTCCACGACATGTGATCTGCACTTCTGAAGACATGCTCAATCCTAATTATGAAGATTTACTTATACG
TAAATCTAACCATAATTTTTTAGTTCAGGCTGGTAATGTTCAACTTAGAGTTGTTGGACATTCTATGCAA
AATTGTGTTCTTAAGCTTAAAGTAGATACAGCTAATCCTAAGACACCTAAGTATAAGTTTGTGCGCATTC
AACCCGGACAGACTTTTTCAGTATTAGCCTGTTACAATGGTTCACCATCTGGTGTTTACCAATGTGCCAT
GAGACCTAATTTTACTATTAAGGGTTCATTCCTTAATGGTTCATGTGGTAGTGTTGGTTTTAATATAGAC
TATGACTGTGTCTCTTTTTGTTATATGCATCATATGGAGTTACCAACGGGAGTTCATGCTGGCACAGACT
TAGAAGGTACCTTCTACGGACCTTTTGTTGACAGACAGACAGCACAAGCGGCTGGTACTGACACAACTAT
TACAGTTAATGTTCTAGCTTGGTTGTATGCAGCTGTTATAAACGGAGATAGATGGTTCCTTAATAGGTTT
ACCACAACTCTAAACGATTTTAATCTTGTGGCTATGAAGTATAATTATGAACCTCTAACACAAGACCATC
TTGACATACTAGGACCTCTTTCAGCTCAAACTGGAATTGCAGTCCTAGATATGTGTGCTTCATTAAAAGA
ATTATTACAAAATGGTATGAATGGACGTACCATATTGGGTAGTGCTTTATTAGAAGATGAATTTACACCT
TTCGATGTTGTTAGACAATGTTCAGGTGTCACCTTTCAAAGTGCAGTGAAAAGGACAATCAAGGGCACGC
ACCATTGGTTGTTGCTTACAGTTTTGACTTCACTCTTAGTTTTAGTTCAGAGTACTCAATGGTCTTTGTT
CTTCTTTGTGTATGAAAATGCCTTTATGCCTTTTGCTATGGGTATTATTGCTATGTCTGCTTTTGCTATG
ATGTTTGTCAAACATAAGCATGCATTCCTCTGTTTGTTCCTGTTACCTTCTCTTGCTACTGTAGCTTATT
TTAATATGGTCTACATGCCTGCTAGTTGGGTGATGCGTATTATGACATGGTTGGATATAGTTGATACTAG
TTTGTCTGGTTTCAAGCTAAAGGACTGTGTTATGTATGCATCAGCTGTAGTGTTATTAATCCTCATGACA
GCAAGAACCGTATATGATGATGGTGCTAGAAGAGTTTGGACACTTATGAATGTCCTGACACTCGTTTATA
AAGTTTATTATGGTAATGCTTTAGACCAAGCTATTTCCATGTGGGCTCTTATAATCTCTGTTACTTCTAA
CTACTCAGGTGTAGTTACAACTGTCATGTTTTTGGCCAGAGGTATTGTTTTTATGTGTGTTGAGTATTGT
CCTATCTTCTTTATAACTGGCAATACACTCCAGTGTATAATGCTAGTTTATTGTTTCTTAGGTTATTTCT
GTACTTGTTATTTTGGTCTCTTCTGTTTACTCAACCGCTATTTTAGGCTTACTCTTGGTGTTTATGACTA
TTTAGTCTCTACACAAGAATTTAGGTACATGAACTCTCAGGGGCTCCTGCCACCTAAGAGTAGTATTGAC
GCTTTCAAGCTTAACATTAAATTGTTGGGCATTGGAGGTAAACCTTGTATTAAGGTTGCTACTGTACAGT
CTAAAATGTCTGACGTAAAGTGCACATCAGTAGTGCTTCTCTCAGTTCTTCAGCAACTTAGAGTAGAGTC
ATCTTCTAAATTGTGGGCACAGTGTGTACAACTTCACAATGATATTCTTCTTGCCAAGGACACTACTGAA
GCTTTTGAGAAGATGGTTTCACTTTTGTCTGTTTTGCTGTCCATGCAGGGTGCTGTAGACATTAACAAGT
TGTGCGAGGAAATGCTCGACAACCGTGCTACCCTTCAGGCTATTGCTTCAGAATTCAGTTCTTTACCTTC
ATATGCTGCTTATGCCACTGCTCAAGAGGCTTATGAGCAGGCTGTAGCAAATGGTGATTCTGAAGTTGTT
CTTAAAAAGTTAAAGAAATCTTTGAATGTGGCTAAATCTGAGTTTGACCGTGATGCTGCCATGCAACGTA
AGTTGGAAAAGATGGCGGATCAGGCTATGACCCAAATGTACAAGCAGGCAAGATCTGAGGACAAGAGGGC
AAAAGTAACTAGTGCAATGCAAACTATGCTTTTCACTATGCTTAGAAAACTTGATAATGATGCACTTAAC
AACATTATCAACAATGCACGTGATGGTTGTGTACCACTCAACATCATACCACTCACAACAGCAGCAAAAC
TCATGGTTGTTGTCCCTGACTATGGAACCTACAAGAATACTTGTGATGGTAACACTTTTACATATGCATC
AGCACTCTGGGAAATCCAGCAAGTTGTTGATGCAGATAGTAAAATTGTGCAGCTTAGTGAAATCAACATG
GACAACTCACCAAATTTGGCTTGGCCTCTTATTGTTACTGCTTTAAGAGCCAATTCAGCTGTCAAACTAC
AGAACAATGAGCTGAGTCCAGTAGCACTACGACAGATGTCCTGTGCGGCTGGTACTACACAGACAGCTTG
TACTGATGACAACGCACTTGCCTACTATAACAATTCTAAGGGAGGTAGGTTTGTGCTTGCATTACTATCA
GACCACCAGGATCTCAAATGGGCTAGATTCCCTAAGAGTGATGGTACAGGTACTATCTATACAGAATTGG
AACCACCTTGCAGGTTTGTTACAGACACACCTAAAGGACCTAAAGTGAAGTATTTGTACTTTATTAAGGG
TCTTAACAACCTAAATAGAGGTATGGTACTGGGTAGTTTGGCTGCCACAGTACGTCTTCAGGCTGGTAAT
GCGACAGAAGTGCCTGCCAATTCAACTGTGCTTTCTTTTTGTGCTTTTGCTGTAGACCCAGCTAAAGCTT
ACAAAGATTACCTAGCAAGTGGTGGACAACCAATCACGAATTGTGTGAAGATGTTGTGTACACACACTGG
TACAGGACAGGCAATCACGGTAACACCAGAAGCCAATATGGATCAAGAATCCTTTGGTGGTGCTTCATGC
TGTCTGTATTGTAGATGCCACATTGATCATCCAAATCCTAAGGGATTTTGTGACTTGAAAGGTAAGTATG
TTCAAATACCTACCACTTGTGTTAATGACCCTGTGGGGTTTACACTCAGAAACACAGTCTGTACCGTCTG
CGGAATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGATGCAGTCTGCGGATGCG
TCAACGTTTTTAAACGGGTTTGCGGTGTAAGTGCGGCCCGTCTTACACCGTGCGGCACAGGCACTAGCAC
TGATGTCGTTTATAGGGCTTTTGATATTTACAACGAGAAAGTTGCTGGTTTTGCAAAGTTCCTAAAAACT
AATTGCTGTCGCTTCCAAGAAAAGGATGAGGAAGGCAATTTATTAGACTCTTATTTCGTAGTTAAGAGGC
ACACAATGTCCAACTACCAACATGAAGAGACTATTTACAACTTGGTTAAAGGGTGTCCAGCCGTTGCTGT
TCATGACTTTTTCAAGTTTAGAGTAGATGGTGACATGGTACCACATATATCACGTCAACGTCTAACTAAA
TACACAATGGCTGATTTAGTCTATGCTCTACGTCATTTTGACGAGGGCAATTGTGATACATTAAAGGAAA
TACTTGTCACATACAAATGTTGTGATGACAACTATTTCAATAAGAAGGATTGGTATGACTTTGTAGAAAA
TCCTGATGTTCTACGCGTATACGCGAACCTAGGTGAGCGTGTACGTCAAGCCTTATTGAAAACTGTGCAA
TTCTGCGATGCTATGCGCGATGCGGGTATCGTAGGTGTACTGACACTAGACAATCAGGATCTGAATGGGA
ATTGGTACGACTTCGGAGATTTCGTACAGGTAGCACCAGGCTGCGGAGTCCCTATTGTGGATTCATACTA
TTCTTTGCTGATGCCTATTCTGACACTCACAAGGGCTTTGGCTGCTGAGTCCCATATGGACGCTGATCTC
GCGAAGCCACTTATTAAGTGGGATTTGCTGAAATATGATTTCACGGAAGAGAGACTATGTCTTTTCGACC
GTTATTTTAAATATTGGGACCAGACGTACCATCCTAATTGTATTAATTGTTTGGATGACAGGTGTATCCT
TCATTGTGCAAACTTTAATGTGTTATTTTCTACTGTGTTTCCACCTACGAGTTTTGGACCACTAGTAAGA
AAGATATTTGTAGATGGTGTACCTTTTGTTGTTTCAACGGGATACCATTTCCGTGAGCTAGGGGTTGTAC
ATAATCAGGATGTAAACTTACATAACTCGCGTCTCAGTTTTAAGGAACTTTTAGTGTACGCTGCTGATCC
AGCTATGCATGCTGCCTCTGGCAATTTGTTGTTAGACAAACGCACTACATGCTTTTCAGTAGCTGCACTA
ACAAACAATGTTGCTTTTCAAACTGTCAAACCCGGTAATTTTAATAAAGACTTTTATGACTTTGCTGTGT
CTAAAGGCTTCTTTAAGGAAGGAAGTTCTGTTGAATTAAAACACTTCTTCTTTGCTCAGGATGGCAATGC
TGCTATCAGTGATTATGACTATTACCGTTATAATCTGCCAACAATGTGTGATATTAGACAACTCCTATTC
GTAGTTGAGGTTGTCGATAAATATTTTGATTGTTACGACGGTGGCTGTATCAATGCCAACCAAGTTATCG
TTAACAATCTGGACAAATCAGCCGGTTTCCCATTTAATAAGTGGGGTAAGGCTAGACTTTATTATGACTC
AATGAGTTATGAGGATCAAGATGCACTGTTCGCATACACTAAGCGTAACGTCATCCCTACAATAACTCAA
ATGAATCTTAAGTATGCCATTAGTGCAAAGAATAGAGCTCGCACTGTTGCTGGTGTCTCTATCTGTAGTA
CTATGACCAATAGACAGTTTCATCAGAAATTATTAAAGTCAATAGCCGCCACTAGAGGAGCTACTGTGGT
AATTGGAACAAGCAAATTTTATGGTGGCTGGCATAACATGTTAAAAACTGTTTACAGTGATGTAGAAAGT
CCTCACCTTATGGGTTGGGACTACCCAAAATGTGACAGAGCCATGCCTAATATGCTTAGAATCATGGCTT
CCCTCGTTCTTGCTCGCAAACATAGCACTTGTTGTAACTTGTCACACCGTTTCTATAGATTAGCTAATGA
GTGTGCACAAGTATTAAGTGAGATGGTCATGTGTGGCGGCTCATTATATGTGAAACCAGGTGGAACATCA
TCCGGTGATGCCACAACTGCTTATGCTAATAGTGTGTTTAACATCTGTCAAGCAGTAACAGCTAATGTAA
ATGCACTTCTTTCAACTGATGGTAATAAGATTGCTGATAAGTATGTCCGCAACCTTCAACACAGACTTTA
CGAGTGTCTCTATAGAAATAGAGACGTAGATCAGGAATTCGTGGATGAATTTTATGCATATTTGCGTAAG
CATTTCTCCATGATGATTCTTTCTGATGATGCCGTCGTATGCTATAATAGTAATTACGCGGCACAGGGTC
TAGTAGCTAGCATTAAGAACTTTAAAGCAGTTCTTTATTACCAAAATAATGTATTCATGTCTGAGGCAAA
ATGTTGGACTGAGACTGACCTTACTAAAGGACCTCATGAATTTTGTTCTCAGCATACCATGCTAGTTAAA
CAGGGAGATGATTATGTGTACCTGCCTTATCCAGATCCATCCAGAATATTAGGCGCAGGCTGTTTTGTCG
ATGACATTGTCAAAACAGATGGTACACTTATGATTGAAAGGTTTGTGTCATTAGCAATTGACGCCTATCC
ACTTACAAAGCACCCTAATCAAGAGTATGCTGATGTTTTCCATTTATACTTACAGTATATTAGGAAATTA
CATGATGAGCTTACTGGTCACATGTTGGACATGTACTCTGTAATGCTAACTAATGACAACACCTCGAGGT
ACTGGGAACCTGAGTTTTATGAGGCAATGTACACACCACACACAGTTTTGCAAGCTGTAGGTGCGTGTGT
GTTATGCAATTCACAGACTTCACTTCGTTGCGGTGCTTGTATTAGGAGACCTTTCCTTTGTTGCAAGTGC
TGCTATGATCACGTCATCTCAACATCACATAAATTAGTGTTGTCTGTTAATCCCTATGTTTGCAATGCAC
CCGGTTGTGATGTCACAGACGTAACACAACTCTATTTGGGAGGTATGAGCTATTACTGCAAGTCACATAA
ACCACCCATTAGTTTTCCGTTGTGTGCTAATGGTCAGGTTTTTGGTTTGTACAAAAACACATGTGTGGGC
AGTGATAACGTAACTGACTTCAATGCAATAGCGACATGCGACTGGACTAATGCTGGCGATTACATACTTG
CCAACACTTGCACAGAGAGACTCAAACTTTTTGCAGCGGAAACGCTCAAAGCTACTGAGGAAACATTCAA
ACTATCTTATGGTATTGCCACTGTTCGTGAAGTACTGTCAGATAGAGAACTTCATCTTTCATGGGAGGTA
GGAAAACCTAGACCACCATTGAATAGAAATTACGTCTTTACTGGTTACCGTGTGACCAAAAATAGTAAAG
TACAGATTGGAGAGTATACCTTTGAAAAAGGTGACTATGGTGATGCTGTTGTGTACAGAGGTACTACAAC
TTATAAATTGAATGTTGGTGATTACTTTGTGTTAACATCACACACAGTAATGCCACTAAGTGCACCAACA
CTAGTGCCACAAGAGCACTATGTGCGAATAACTGGCTTATACCCTACACTTAATATCTCTGATGAGTTTT
CTAGCAATGTTGCAAATTACCAAAAGGTCGGCATGCAGAAGTACTCCACACTCCAGGGACCACCTGGTAC
TGGTAAGAGTCACTTTGCTATTGGACTTGCCCTCTACTACCCATCTGCCCGCATAGTGTATACAGCTTGC
TCTCATGCTGCTGTTGATGCGCTATGTGAGAAGGCATTAAAATACTTGCCTATAGATAAGTGTAGTAGAA
TTATTCCTGCACGTGCGCGTGTAGAGTGTTTTGACAAATTCAAAGTGAATTCAACCTTAGAACAGTATGT
TTTCTGCACTGTCAATGCGCTGCCTGAAACTACTGCTGATATAGTGGTCTTTGATGAAATTTCAATGGCC
ACTAATTATGATTTGAGTGTTGTCAATGCCAGACTACGTGCAAAACACTACGTTTACATTGGTGATCCGG
CTCAATTACCTGCACCACGCACATTGCTAACAAAAGGCACACTTGAACCAGAATATTTCAATTCAGTGTG
CAGACTTATGAAAACAATAGGTCCAGACATGTTCCTTGGGACTTGTCGTCGTTGTCCCGCTGAAATTGTT
GACACAGTGAGTGCTTTAGTTTATGATAATAAGCTAAAAGCACACAAAGAGAAGTCAGCTCAATGCTTCA
AGATGTTTTACAAGGGTGTGATTACGCATGATGTGTCATCCGCAATCAACAGACCACAAATAGGTGTAGT
AAGAGAATTTCTTACGCGCAATCCAGCTTGGAGAAAAGCTGTTTTTATTTCACCATATAATTCACAGAAT
GCAGTGGCATCAAAGATTTTAGGGTTGCCTACTCAAACTGTTGATTCTTCACAGGGTTCTGAATATGACT
ATGTCATATTCACACAAACCACTGAGACTGCACACTCTTGTAATGTAAACCGCTTTAATGTGGCCATTAC
AAGAGCAAAGATTGGCATTTTGTGCATAATGTCTGATAGAGACCTTTATGACAAGCTTCAATTTATGAGT
CTAGAAGTACCGCGTCGAAATGTGGCTACTTTACAAGCAGAAAATGTGACTGGACTCTTTAAGGACTGTA
GCAAGATCATTACTGGTCTTCATCCAACACAGGCACCTACGCATCTCAGTGTTGATACTAAATTCAAGAC
TGAAGGACTTTGTGTCGACATACCAGGAATACCAAAGGACATGACCTATCGTAGACTCATCTCTATGATG
GGCTTTAAAATGAATTACCAAGTTAATGGTTACCCTAATATGTTTATCACCCGTGAAGAAGCTATTCGTC
ACGTTCGTGCATGGATAGGCTTTGATGTTGAGGGTTGTCATGCGACTAGAGATGCTGTAGGAACAAATCT
ACCACTCCAGTTAGGGTTTTCAACAGGTGTTAACCTAGTGGCTGTACCAACTGGCTATGTTGACACTGAG
CACAGCACAGAATTTACCAGAGTTAATGCAAAACCTCCTCCAGGTGATCAATTTAAGCATCTTATACCAC
TTATGTACAAAGGCTTGCCCTGGAACGTGGTGCGTATTAAGATTGTTCAAATGCTCAGTGATACACTGAA
AGGATTATCAGACAGAGTTGTGTTTGTCCTTTGGGCACATGGCTTTGAACTTACATCGATGAAGTATTTT
GTTAAGATCGGACCAGAAAGAACGTGTTGTCTGTGTGACAAACGCGCGACTTGCTTCTCTACTTCATCTG
ACACTTATGCCTGTTGGAATCACTCTGTGGGCTTTGACTATGTCTATAACCCGTTTATGATTGATGTCCA
GCAGTGGGGTTTTACAGGTAACCTTCAAAGTAACCATGATCAACACTGCCAAGTGCATGGTAATGCCCAT
GTAGCTAGTTGTGATGCTATCATGACTAGATGTCTTGCAGTCCATGAGTGCTTTGTTAAGCGCGTTGATT
GGTCTGTTGAATACCCGATTATTGGAGATGAACTGAAGATTAATGCCGCATGCAGAAAAGTACAGCATAT
GGTTGTTAAATCTGCATTGCTTGCTGATAAATTCCCAGTTCTTCATGATATAGGAAACCCAAAGGCTATT
AGATGTGTGCCGCAGTCTGAAGTGGACTGGAAATTCTACGACGCTCAGCCTTGCAGTGACAAAGCTTATA
AAATAGAAGAACTCTTCTACTCATATGCCACACATCATGACAAGTTCACAGATGGTGTTTGCTTGTTTTG
GAACTGTAACGTTGATCGTTACCCGGCTAATGCTATTGTGTGTAGGTTTGATACTAGAGTGCTTTCTAAT
TTAAACCTACCAGGTTGTGATGGTGGTAGTTTGTATGTTAATAAGCATGCGTTCCACACTCCAGCTTTTG
ATAAGAGTGCATTTACACATTTGAAACAACTGCCTTTCTTTTATTACTCTGACAGTCCGTGTGAGTCTCA
TGGTAAACAGGTTGTGTCAGATATTGATTATGTCCCACTAAAGTCTGCTACGTGTATTACACGATGCAAC
TTAGGTGGTGCCGTTTGTAGACATCATGCAAACGAGTACAGACAGTACTTGGATGCATATAATATGATGA
TTTCTGCTGGATTTAGCCTTTGGATTTATAAACAATTTGATACTTACAACTTGTGGAACACTTTCACCAA
GTTGCAGAGTTTAGAAAATGTGGCTTATAATGTTATCAACAAGGGACACTTTGATGGACAGAATGGTGAA
GCACCTGTGTCTATCGTTAATAATGCTGTTTACACTAAGTTAGATGGTGTTGATGTGGAGATCTTTGAAA
ATAAGACAACACTTCCTGTTAATGTTGCATTTGAGCTTTGGGCTAAACGTAACATTAAACCGGTGCCAGA
GATTAAAATACTCAATAATTTGGGTGTTGATATCGCTGCTAATACTGTTATATGGGACTACAAGAGAGAA
GCGCCAGCGCATGTTTCTACAATAGGTGTCTGTACAATGACTGACATTGCAAAGAAACCTACTGAGAGTG
CTTGTTCATCACTTACTGTCTTATTTGATGGTAGAGTTGAGGGACAGGTAGACCTTTTTAGAAACGCCCG
TAATGGTGTTTTAATAACAGAAGGTTCAGTTAAGGGCTTAACACCTTCGAAAGGACCTGCACAGGCTAGT
GTCAACGGAGTCACATTAATTGGAGAATCAGTAAAAACACAGTTCAATTACTTTAAGAAAGTGGATGGCA
TTATTCAGCAATTGCCAGAAACCTACTTTACTCAAAGCAGAGACTTAGAGGATTTCAAGCCCAGATCACA
AATGGAAACTGATTTCCTTGAGCTCGCTATGGATGAATTCATAGAACGATATAAGCTAGATGGCTATGCT
TTCGAGCACATCGTTTATGGAGATTTTAGTCATGGACAATTAGGCGGACTTCATTTATTGATAGGACTGG
CCAAAAGGTCACAGGACTCACTGTTAAAGCTAGAGGATTTTATTCCTATGGATAGCACAGTGAAAAACTA
CTTCATAACAGATGCGCAAACGGGTTCATCTAAGTGTGTATGCTCTGTTATCGACCTTTTACTTGATGAC
TTTGTTGAAATAATAAAGTCACAAGATCTTTCAGTGGTTTCAAAAGTAGTCAAAGTTACGATTGATTATA
CAGAAATTTCATTTATGCTTTGGTGTAAAGATGGGCATGTGGAAACTTTTTACCCAAAATTACAATCTAG
TCAAGCATGGCAACCAGGTGTTGCTATGCCTAATCTCTATAAAATGCAGAGAATGTTACTGGAAAAGTGT
GATCTTCAAAATTATGGTGATAGTGCTATATTGCCTAAAGGCATAATGATGAATGTCGCAAAGTACACTC
AACTGTGTCAGTATTTAAATACACTTACTTTAGCTGTGCCCTATAATATGAGAGTTATACATTTTGGCGC
GGGCTCTGATAAAGGAGTAGCACCTGGCACAGCTGTTCTTAGACAGTGGTTGCCAACTGGTACACTACTT
GTCGATTCTGATTTAAATGATTTTGTTTCTGATGCAGACTCAACATTAATTGGTCATTGTGCAACCGTAC
ATACGGCTAATAAATGGGATCTCATTATTAGCGATATGTATGATCCTAAGACTAAAAATGTTACAAAAGA
GAATGATTCCAAAGAAGGATTTTTCACTTACATTTGTGGATTTATACAGCAAAAATTAGCCCTCGGAGGT
TCCGTAGCTGTAAAGATAACAGAGCATTCCTGGAATGCTGATCTTTATAAGCTCATGGGACACTTCGCAT
GGTGGACAGCTTTTGTTACTAATGTTAATGCTTCATCTTCAGAGGCTTTCTTAATTGGTTGTAATTATCT
TGGCAAACCACGTGAGCAGATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAACACAAAT
CCAATACAATTGTCTTCCTACTCATTATTTGACATGAGTAAGTTTCCTCTTAAATTAAGAGGTACTGCTG
TTATGTCATTAAAAGATGGACAAATCAATGATATGATTTTGTCTCTTCTTAGTAAAGGCAGACTTATTGT
TAGAGAGAATAATAGAGTTATTATCTCTAGTGATGTTCTTGTTAACAACTAAACGAACATGTTGTTTTTC
TTGTTTCTTCAGTTCGCCTTAGTAAACTCCCAGTGTGTTAACTTGACAGGCAGAACCCCACTCAATCCCA
ATTATACTAATTCTTCACAAAGAGGTGTTTATTACCCTGACACAATTTATAGATCAGACACACTTGTGCT
CAGCCAGGGTTATTTTCTTCCATTTTATTCTAATGTTAGCTGGTATTACTCATTAACAACCAACAATGCT
GCCACAAAGAGGACTGATAATCCTATATTAGATTTCAAGGACGGCATATACTTTGCTGCCACTGAACACT
CAAATATTATCAGGGGCTGGATCTTTGGAACAACTCTTGACAACACTTCTCAATCTCTCTTGATAGTTAA
CAACGCAACGAATGTTATTATCAAGGTTTGTAATTTTGATTTTTGTTATGATCCCTACCTTAGTGGTTAC
TATCATAACAACAAAACATGGAGCATCAGAGAATTTGCTGTCTATTCTTCTTATGCTAATTGTACTTTTG
AGTATGTTTCGAAATCCTTTATGTTGAACATTTCTGGTAATGGTGGTCTGTTCAACACTCTTAGAGAGTT
TGTTTTCAGAAATGTCGATGGGCATTTCAAGATTTACTCAAAGTTTACACCAGTAAATTTAAATCGTGGC
TTGCCTACTGGTCTCTCAGTGCTTCAGCCATTGGTTGAATTACCAGTTAGCATAAATATTACTAAATTCA
GAACACTCCTCACTATTCATAGAGGAGACCCTATGCCTAATAACGGCTGGACTGCTTTTTCAGCTGCTTA
TTTCGTGGGCTATCTTAAACCACGTACCTTTATGCTGAAATATAATGAGAATGGCACCATTACTGATGCT
GTTGATTGTGCACTTGACCCTCTTTCGGAGACAAAGTGTACGTTAAAATCTCTTACTGTCCAAAAGGGCA
TCTATCAGACTTCTAACTTCCGAGTGCAACCCACTCAGTCTGTAGTTAGATTTCCTAATATTACCAATGT
GTGTCCATTTCACAAGGTTTTTAATGCCACGAGGTTTCCTTCCGTCTATGCGTGGGAAAGAACTAAAATT
TCTGATTGCATTGCAGATTACACTGTTTTCTACAATTCAACTTCTTTTTCTACTTTTAAATGTTATGGTG
TTTCACCTTCTAAATTGATTGATTTGTGCTTTACGAGTGTGTATGCTGATACATTTCTCATAAGATTCTC
AGAAGTCAGACAGGTGGCACCAGGACAAACTGGTGTCATTGCTGACTATAATTATAAATTACCTGATGAT
TTTACAGGTTGTGTCATAGCTTGGAACACTGCCAAACAGGATGTAGGTAATTATTTCTACAGGTCTCATC
GTTCTACCAAATTGAAACCATTTGAAAGAGATCTTTCCTCAGACGAGAATGGTGTCCGTACACTTAGTAC
TTATGACTTCAACCCTAATGTACCACTTGAATACCAAGCTACAAGGGTTGTTGTTTTGTCATTTGAGCTT
CTAAATGCACCAGCTACAGTTTGTGGACCAAAACTATCCACACAACTAGTAAAAAATCAGTGCGTTAATT
TCAACTTTAACGGACTCAAGGGCACTGGTGTCTTGACTGATTCTTCCAAGAGGTTTCAGTCATTCCAACA
ATTTGGTAAAGATGCGTCTGACTTTATTGATTCAGTACGTGATCCTCAAACACTTGAGATACTTGACATT
ACACCTTGCTCTTTTGGTGGTGTCAGTGTTATAACACCAGGAACAAACACTTCTTTAGAGGTGGCTGTTC
TTTACCAAGATGTTAACTGCACTGATGTACCAACTACTATACATGCAGACCAACTAACACCTGCTTGGCG
TATTTATGCTACTGGCACTAATGTGTTTCAAACTCAAGCAGGCTGTCTTATAGGAGCTGAACATGTCAAT
GCTTCTTATGAGTGTGACATCCCAATTGGTGCTGGTATTTGTGCTAGCTACCATACGGCTTCTATATTAC
GCAGTACAAGCCAGAAAGCTATTGTGGCTTATACTATGTCCCTTGGTGCTGAGAACTCTATCGCTTATGC
TAACAATTCTATAGCCATACCTACAAATTTTTCAATTAGTGTTACCACTGAAGTTATGCCTGTATCAATG
GCTAAAACTTCTGTAGATTGTACTATGTATATCTGTGGTGACTCTATAGAGTGTAGCAACTTGTTGTTAC
AATATGGCAGTTTTTGCACACAACTAAATCGTGCTTTAAGTGGGATTGCTATTGAGCAAGACAAGAACAC
CCAAGAGGTTTTTGCTCAAGTTAAGCAAATCTATAAAACACCACCTATTAAGGATTTTGGTGGTTTTAAT
TTTTCACAGATACTACCTGACCCATCTAAACCCAGCAAGAGGTCGTTTATTGAAGACTTACTCTTCAATA
AAGTCACTCTTGCTGATGCCGGTTTTATCAAACAGTACGGTGATTGTTTGGGTGGTATTTCTGCTAGAGA
TTTGATTTGTGCTCAAAAGTTCAATGGACTTACTGTCTTACCACCATTGCTCACAGATGAAATGATCGCT
GCTTATACAGCTGCATTAATTAGCGGCACTGCCACTGCTGGATGGACCTTTGGTGCTGGTGCTGCTCTTC
AAATACCATTTGCCATGCAAATGGCTTATAGGTTTAATGGAATTGGAGTTACTCAGAATGTTCTCTATGA
GAATCAGAAATTAATAGCCAATCAGTTTAATAGTGCTATTGGAAAAATCCAAGAGTCTTTGACATCTACA
GCTAGTGCACTTGGAAAATTGCAGGATGTTGTTAACCAAAATGCACAAGCTTTAAACACGCTTGTTAAAC
AACTTAGTTCCAATTTTGGTGCAATTTCAAGCGTGTTGAATGACATTCTTTCACGCCTTGACAAAGTCGA
GGCTGAGGTTCAGATTGATAGGTTGATCACAGGTAGACTTCAGAGTTTACAGACGTATGTGACTCAACAA
TTAATCAGAGCTGCAGAAATCAGAGCTTCTGCTAATCTTGCTGCGACTAAAATGTCCGAGTGTGTACTAG
GACAATCTAAAAGAGTTGATTTTTGTGGAAAAGGTTATCACCTAATGTCTTTTCCCCAGTCAGCGCCTCA
TGGTGTTGTCTTCTTACATGTGACTTACATTCCTTCGCAAGAAAAGAACTTCACAACAGCTCCTGCCATT
TGCCATGAAGGTAAAGCACACTTCCCACGTGAAGGTGTTTTCGTTTCGAATGGCACACACTGGTTTGTAA
CACAAAGGAACTTTTATGAACCTAAAATTATAACCACTGACAATACATTTGTCTCTGGTAACTGTGATGT
TGTAATTGGAATTATCAACAACACAGTTTATGATCCTTTACAACCAGAACTTGATTCATTTAAGGAGGAG
TTAGATAAATATTTTAAAAATCATACATCACCTGATATTGATCTTGGTGATATTTCTGGCATTAATGCTT
CTGTTGTCAATATTCAAAAGGAAATTGACCGCCTCAATGAGGTTGCCAGAAATTTAAATGAATCACTCAT
TGATCTCCAAGAACTTGGAAAATATGAGCAATATATCAAATGGCCATGGTATGTTTGGCTCGGCTTCATT
GCTGGACTCATTGCTATAGTCATGGTTACAATCCTGCTTTGTTGCATGACAAGTTGTTGCAGTTGTCTCA
AGGGCTGTTGTTCTTGCGGATCTTGCTGTAAATTTGATGAAGACGACTCTGAGCCTGTGCTCAAAGGAGT
CAAATTACATTACACATAAACGAACTTATGGATTTGTTTATGAGAATTTTCACTCTTGGAACTGTTACTC
TTAAACAAGGTGAAATCAAAGGTGCTACTCCTACAAATTCTGTTCGCACTACTGCAACAATACCGATACA
AGCCACACTCCCTTTCGGATGGCTTGTTGTTGGCGTTGCAATTCTTGCTGTTTTTCAAAGCGCTTCAAAA
ATAATTACACTCAAAAAGAGATGGCAGTTAGCCCTCTCTAAAGGTGTTCATTTTGTTTGCAACTTGCTTC
TGCTGTTTTTAACAGTTTATTCTCACTTGTTGCTTCTTGCTGGTGGCTTGGAAGCCACTTTTCTCTTTCT
TTATGCATTAGCTTATTGCTTGCAAACTGTAAATTTTGTGAGAATAATAATGCGATTCTGGTTGTGCTGG
AAGTGCCGTTCCAAGAATCCTTTACTCTATGATGCCAACTACTTTCTTTGTTGGCATACTAATTGTTATG
ACTATTGTATACCATACAATAGTGTAACCTCTTCAATTGTCATCACATGTGGTGATGGTACTACGAATCC
CATTTCTGAGGACGACTACCAAATTGGTGGTTACACGGAAAAGTGGGAGTCTGGTGTTAAGGACTGTGTT
GTATTACATAGTTATTTCACCTCAGATTACTACCAGCTGTACTCAACACAAGTGAGTACAGACACTGGTG
TTGAACATGTTACTTTCTTCATCTACAATAAAATTGTTGATGAGCCTGAAGAACATGTTCAAATTCACAC
AATCGACGGTACATCTGGAGTTGTTAATCCAGCAATGGAACCAATTTATGATGAACCGACGACGACTACT
AGCGTGCCTTTGTAAGCACAAGCTGATGAGTACGAACTTATGTACTCATTCGTTTCGGAAGAGACAGGTA
CGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTTGTGGTATTCTTGCTAGTCACACTAGCCATCCT
TACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTCTTTTTAC
GTTTACTCTCGTGTTAAAAATCTGAATTCTTCTAGAGTTCCTGATCTTTTGGTCTAAACGAACTAAATAT
TATATTAGTCTTTCTGTTTGGAACTTTAATTTTAGCCATGTCAGGTGACAACGGTACCATTACCGTTGAA
GAGCTTAAAAAGCTCTTAGAACAATGGAACCTAGTAATAGGATTCTTGTTTCTTACATGGATTTGTTTGT
TACAATTTGCCTATGCCAACAGGAATAGGTTTTTGTACATAATTAAGTTAATTTTCCTCTGGCTGCTTTG
GCCAGTAACTTTAGCTTGCTTTGTGCTTGCTGCTGTTTACAGAATAAACTGGATCACTGGTGGAATTGCC
ATTGCAATGGCCTGTCTTGTAGGCTTGATGTGGCTTAGCTACTTCATTGCTTCTTTCAGGCTGTTTGCTC
GTACGCGTTCCATGTGGTCATTTAACCCAGAAACTAACATTCTTTTGAACGTGCCTCTTCATGGCACAAT
TCTGACCAGGCCGCTTCTAGAGAGTGAACTCGTAATTGGAGCTGTGATCCTTCGTGGACATCTTCGTATT
GCAGGACACCATCTGGGACGCTGTGACATCAAGGACCTGCCCAAAGAAATCACTGTAGCTACATCACGAA
CGCTTTCTTATTACAAATTGGGAGCTTCGCAGCGTGTAGCAGGTGACTCAGGTTTTGCTGCATACAGTCG
CTACAGGATTGGTAATTACAAATTAAATACAGACCATTCCAGTAGCAGTGACAATATTGCTTTGCTTGTA
CAGTAAGTGACAACAGATGTTTCATCTCGTTGACTTTCAGGTTACTATAGCAGAGATATTATTAATTATT
ATGAGGACTTTTAAAGTTTCCATTTGGAATCTTGATTATATCATAAATCTCATAATTAAAAATCTATCTA
AGCCTCCAACTGAGAATAACTGTTCTCAATTAGATGAAGAGCAACCAATGGAGATTGATTAAACTAACAT
GAAAATTATTTTCTTCTTGGTACTGATAACACTTGTTACTGGCGAGCTTTACCACTACCAAGAGTGTATA
AAAGGTACAACTGTACTTTTAAAAGAACCTTGCTCTTCAGGAACATATGAAGGCAATTCACCATTTCATC
CTCTAGCTGATAATAAATTTGCACTGGCTTGCTTTAGCACTCAATTTGCTTTTGCTTGTCCTGACGGTGT
TAGACACACCTTTCAGTTACGTGCGAGATCAGTTTCACCCAAACTGTTTACCAGACAAGAGGAAGTTCAA
GAATTATACTCACCTGTTTTCCTTATCGTTGCAGCTATAGTGTTCATAATACTTTGCTTCACATTCAAAA
GAAAAATAGAATGAGTGAATTTTCATTAATTGACTTCTATTTGTGCTTCTTAGCCTTTCTGCTATTCCTT
GTTTTAATTATGCTCATTATCTTTTGGTTCTCACTAGAACTGCAAGATCATAATGAAACTTTCCACGCCT
AAACGAACATGAAATTTCTTGTTTTCTTAGGAATTCTTACAACAGTAGCTGCATTCCATCAGGAATGTAG
TTTACAGTCATGTGCTCAGCATCAACCCTATGTAGTTGATGACCCTTGTCCAATTCACTTCTACTCACGA
TGGTATATCAGAGTGGGAGCTAGAAAATCAGCACCTTTGATTGAATTGTGTGTTGATGAGGTAGGCTCTA
AGTCACCCATTCAATACATTGACATTGGTAATTACACAGTTTCCTGTTCTCCTTTTACAATTAATTGCCA
GGAACCTAAATTAGGTAGTCTCGTAGTACGGTGTTCGTATTATGAAGACTTTCTAGAGTACCATGACATT
CGTGTTGTCTTAGATTTCATCTAAACGAACTAACTAAAATGTCTGATAATGGACCCCAAAACCAACGTAG
TGCACCCCGCATTACATTTGGTGGACCCTCAGATTCAAGTGACAATAGCAAAAACGGAGAGCGCAATGGT
GCACGACCTAAACAACGTCGACCCCAAGGCTTACCCAATAATACTGCATCTTGGTTCACCGCTCTCACTC
AACATGGCAAGGAAAACCTTACGTTCCCTCGAGGGCAAGGTGTTCCAATCAACACCAATAGCTCTAAAGA
TGACCAAATTGGCTACTACCGTAGAGCTACCAGACGAATTCGTGGTGGTGACGGTAAAATGAAAGAGCTC
AGCCCCAGATGGTATTTTTACTATCTAGGAACTGGACCAGAAGCTGGACTTCCCTATGGTGCTAACAAAG
AAGGCATCATATGGGTTGCAACTGAGGGAGCCTTAAACACACCGAAAGACCACATTGGCACCCGCAATCC
TGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAA
GGGAGCAGAGGCGGCAGTCAAGCTTCTTCACGCTCCTCATCACGTAGTCGCAACAGTTCAAGAAACTCAA
CTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGACACTGCTCTTGCTTT
GCTGCTGCTAGATAGGTTGAACCAGCTTGAGAACAAAGTATCTGGCAAAGGCCAACAACAACAGGGCCAA
ACTGTCACTAAGAAATCTGCTGCTGAGGCATCTAAAAAGCCTCGCCAAAAACGTACTGCTACAAAACAGT
ACAACGTCACTCAAGCATTTGGGAGACGTGGTCCAGAACAAACCCAAGGAAATTTTGGGGACCAAGAATT
AATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCTCCAAGTGCCTCTGCATTC
TTTGGAATGTCACGCATTGGCATGGAAGTCACACCTTCGGGAACATGGCTGACTTATCATGGAGCCATTA
AATTGGATGACAAAGATCCACAATTCAAAGATAACGTCATACTGCTGAATAAGCACATTGACGCATACAA
AACATTCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAAAAGGCTGATGAACTTCAGGCTTTACCGCAG
AGACAGAAGAAACAACAAACTGTGACCCTTCTTCCTGCTGCAGATTTGGATGAATTCTCCAAACAGTTGC
AACAATCCATGAGTGGTACTGATTCAACCCAGGCTTAAACTCGTGCAGACCACACAAGGCAGATGGGCTA
TATAAACGTTTTCGCTTTTCCGTTTACGATATATAGTCTACTCTTGTGCAGAATGAATTCTCGTAACTAC
ATAGCACAAGTAGATGTAGTTAACTTTAATTTCACATAGCAATCTTTAATCAATGTGTAACATTGGGGAG
GACTTGAAAGAGCCACCACGTTTTCACCGAGGCCACGCGGAGTACGATCGAGGGTACAGCCAATAATGTT
AGGGAGAGCAGCCTATATGGAAGAGCCCTAATGTGTAAAATTAATTTTAGTAGTGCTATCCCCATGTGAT
TTTAATAGCTTCAACCACTCGACAAGAAAAAAAAAAAAAAAAAAAAAAAAAA

$ curl -s ‘https://www.ncbi.nlm.nih.gov/sviewer/viewer.cgi?report=fasta&id=MN988713.1’
>MN988713.1 Severe acute respiratory syndrome coronavirus 2 isolate 2019-nCoV/USA-IL1/2020, complete genome
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAA
CGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAAC
TAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTG
TTGCAGCCGATCATCAGCACATCTAGGTTTCGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTC
CCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTTACAGGTTCGCGACGTGCTCGTAC
GTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAGATGGCACTTGTGG
CTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTCATCAAACGTTCGGAW
GCTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTCAGTACGGTC
GTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGCTTACCGCAAGGTTCT
TCTTCGTAAGAACGGTAATAAAGGAGCTGGTGGCCATAGTTACGGCGCCGATCTAAAGTCATTTGACTTA
GGCGACGAGCTTGGCACTGATCCTTATGAAGATTTTCAAGAAAACTGGAACACTAAACATAGCAGTGGTG
TTACCCGTGAACTCATGCGTGAGCTTAACGGAGGGGCATACACTCGCTATGTCGATAACAACTTCTGTGG
CCCTGATGGCTACCCTCTTGAGTGCATTAAAGACCTTCTAGCACGTGCTGGTAAAGCTTCATGCACTTTG
TCCGAACAACTGGACTTTATTGACACTAAGAGGGGTGTATACTGCTGCCGTGAACATGAGCATGAAATTG
CTTGGTACACGGAACGTTCTGAAAAGAGCTATGAATTGCAGACACCTTTTGAAATTAAATTGGCAAAGAA
ATTTGACACCTTCAATGGGGAATGTCCAAATTTTGTATTTCCCTTAAATTCCATAATCAAGACTATTCAA
CCAAGGGTTGAAAAGAAAAAGCTTGATGGCTTTATGGGTAGAATTCGATCTGTCTATCCAGTTGCGTCAC
CAAATGAATGCAACCAAATGTGCCTTTCAACTCTCATGAAGTGTGATCATTGTGGTGAAACTTCATGGCA
GACGGGCGATTTTGTTAAAGCCACTTGCGAATTTTGTGGCACTGAGAATTTGACTAAAGAAGGTGCCACT
ACTTGTGGTTACTTACCCCAAAATGCTGTTGTTAAAATTTATTGTCCAGCATGTCACAATTCAGAAGTAG
GACCTGAGCATAGTCTTGCCGAATACCATAATGAATCTGGCTTGAAAACCATTCTTCGTAAGGGTGGTCG
CACTATTGCCTTTGGAGGCTGTGTGTTCTCTTATGTTGGTTGCCATAACAAGTGTGCCTATTGGGTTCCA
CGTGCTAGCGCTAACATAGGTTGTAACCATACAGGTGTTGTTGGAGAAGGTTCCGAAGGTCTTAATGACA
ACCTTCTTGAAATACTCCAAAAAGAGAAAGTCAACATCAATATTGTTGGTGACTTTAAACTTAATGAAGA
GATCGCCATTATTTTGGCATCTTTTTCTGCTTCCACAAGTGCTTTTGTGGAAACTGTGAAAGGTTTGGAT
TATAAAGCATTCAAACAAATTGTTGAATCCTGTGGTAATTTTAAAGTTACAAAAGGAAAAGCTAAAAAAG
GTGCCTGGAATATTGGTGAACAGAAATCAATACTGAGTCCTCTTTATGCATTTGCATCAGAGGCTGCTCG
TGTTGTACGATCAATTTTCTCCCGCACTCTTGAAACTGCTCAAAATTCTGTGCGTGTTTTACAGAAGGCC
GCTATAACAATACTAGATGGAATTTCACAGTATTCACTGAGACTCATTGATGCTATGATGTTCACATCTG
ATTTGGCTACTAACAATCTAGTTGTAATGGCCTACATTACAGGTGGTGTTGTTCAGTTGACTTCGCAGTG
GCTAACTAACATCTTTGGCACTGTTTATGAAAAACTCAAACCCGTCCTTGATTGGCTTGAAGAGAAGTTT
AAGGAAGGTGTAGAGTTTCTTAGAGACGGTTGGGAAATTGTTAAATTTATCTCAACCTGTGCTTGTGAAA
TTGTCGGTGGACAAATTGTCACCTGTGCAAAGGAAATTAAGGAGAGTGTTCAGACATTCTTTAAGCTTGT
AAATAAATTTTTGGCTTTGTGTGCTGACTCTATCATTATTGGTGGAGCTAAACTTAAAGCCTTGAATTTA
GGTGAAACATTTGTCACGCACTCAAAGGGATTGTACAGAAAGTGTGTTAAATCCAGAGAAGAAACTGGCC
TACTCATGCCTCTAAAAGCCCCAAAAGAAATTATCTTCTTAGAGGGAGAAACACTTCCCACAGAAGTGTT
AACAGAGGAAGTTGTCTTGAAAACTGGTGATTTACAACCATTAGAACAACCTACTAGTGAAGCTGTTGAA
GCTCCATTGGTTGGTACACCAGTTTGTATTAACGGGCTTATGTTGCTCGAAATCAAAGACACAGAAAAGT
ACTGTGCCCTTGCACCTAATATGATGGTAACAAACAATACCTTCACACTCAAAGGCGGTGCACCAACAAA
GGTTACTTTTGGTGATGACACTGTGATAGAAGTGCAAGGTTACAAGAGTGTGAATATCACTTTTGAACTT
GATGAAAGGATTGATAAAGTACTTAATGAGAAGTGCTCTGCCTATACAGTTGAACTCGGTACAGAAGTAA
ATGAGTTCGCCTGTGTTGTGGCAGATGCTGTCATAAAAACTTTGCAACCAGTATCTGAATTACTTACACC
ACTGGGCATTGATTTAGATGAGTGGAGTATGGCTACATACTACTTATTTGATGAGTCTGGTGAGTTTAAA
TTGGCTTCACATATGTATTGTTCTTTCTACCCTCCAGATGAGGATGAAGAAGAAGGTGATTGTGAAGAAG
AAGAGTTTGAGCCATCAACTCAATATGAGTATGGTACTGAAGATGATTACCAAGGTAAACCTTTGGAATT
TGGTGCCACTTCTGCTGCTCTTCAACYTGAAGAAGAGCAAGAAGAAGATTGGTTAGATGATGATAGTCAA
CAAACTGTTGGTCAACAAGACGGCAGTGAGGACAATCAGACAACTACTATTCAAACAATTGTTGAGGTTC
AACCTCAATTAGAGATGGAACTTACACCAGTTGTTCAGACTATTGAAGTGAATAGTTTTAGTGGTTATTT
AAAACTTACTGACAATGTATACATTAAAAATGCAGACATTGTGGAAGAAGCTAAAAAGGTAAAACCAACA
GTGGTTGTTAATGCAGCCAATGTTTACCTTAAACATGGAGGAGGTGTTGCAGGAGCCTTAAATAAGGCTA
CTAACAATGCCATGCAAGTTGAATCTGATGATTACATAGCTACTAATGGACCACTTAAAGTGGGTGGTAG
TTGTGTTTTAAGCGGACACAATCTTGCTAAACACTGTCTTCATGTTGTCGGCCCAAATGTTAACAAAGGT
GAAGACATTCAACTTCTTAAGAGTGCTTATGAAAATTTTAATCAGCACGAAGTTCTACTTGCACCATTAT
TATCAGCTGGTATTTTTGGTGCTGACCCTATACATTCTTTAAGAGTTTGTGTAGATACTGTTCGCACAAA
TGTCTACTTAGCTGTCTTTGATAAAAATCTCTATGACAAACTTGTTTCAAGCTTTTTGGAAATGAAGAGT
GAAAAGCAAGTTGAACAAAAGATCGCTGAGATTCCTAAAGAGGAAGTTAAGCCATTTATAACTGAAAGTA
AACCTTCAGTTGAACAGAGAAAACAAGATGATAAGAAAATCAAAGCTTGTGTTGAAGAAGTTACAACAAC
TCTGGAAGAAACTAAGTTCCTCACAGAAAACTTGTTACTTTATATTGACATTAATGGCAATCTTCATCCA
GATTCTGCCACTCTTGTTAGTGACATTGACATCACTTTCTTAAAGAAAGATGCTCCATATATAGTGGGTG
ATGTTGTTCAAGAGGGTGTTTTAACTGCTGTGGTTATACCTACTAAAAAGGCTGGTGGCACTACTGAAAT
GCTAGCGAAAGCTTTGAGAAAAGTGCCAACAGACAATTATATAACCACTTACCCGGGTCAGGGTTTAAAT
GGTTACACTGTAGAGGAGGCAAAGACAGTGCTTAAAAAGTGTAAAAGTGCCTTTTACATTCTACCATCTA
TTATCTCTAATGAGAAGCAAGAAATTCTTGGAACTGTTTCTTGGAATTTGCGAGAAATGCTTGCACATGC
AGAAGAAACACGCAAATTAATGCCTGTCTGTGTGGAAACTAAAGCCATAGTTTCAACTATACAGCGTAAA
TATAAGGGTATTAAAATACAAGAGGGTGTGGTTGATTATGGTGCTAGATTTTACTTTTACACCAGTAAAA
CAACTGTAGCGTCACTTATCAACACACTTAACGATCTAAATGAAACTCTTGTTACAATGCCACTTGGCTA
TGTAACACATGGCTTAAATTTGGAAGAAGCTGCTCGGTATATGAGATCTCTCAAAGTGCCAGCTACAGTT
TCTGTTTCTTCACCTGATGCTGTTACAGCGTATAATGGTTATCTTACTTCTTCTTCTAAAACACCTGAAG
AACATTTTATTGAAACCATCTCACTTGCTGGTTCCTATAAAGATTGGTCCTATTCTGGACAATCTACACA
ACTAGGTATAGAATTTCTTAAGAGAGGTGATAAAAGTGTATATTACACTAGTAATCCTACCACATTCCAC
CTAGATGGTGAAGTTATCACCTTTGACAATCTTAAGACACTTCTTTCTTTGAGAGAAGTGAGGACTATTA
AGGTGTTTACAACAGTAGACAACATTAACCTCCACACGCAAGTTGTGGACATGTCAATGACATATGGACA
ACAGTTTGGTCCAACTTATTTGGATGGAGCTGATGTTACTAAAATAAAACCTCATAATTCACATGAAGGT
AAAACATTTTATGTTTTACCTAATGATGACACTCTACGTGTTGAGGCTTTTGAGTACTACCACACAACTG
ATCCTAGTTTTCTGGGTAGGTACATGTCAGCATTAAATCACACTAAAAAGTGGAAATACCCACAAGTTAA
TGGTTTAACTTCTATTAAATGGGCAGATAACAACTGTTATCTTGCCACTGCATTGTTAACACTCCAACAA
ATAGAGTTGAAGTTTAATCCACCTGCTCTACAAGATGCTTATTACAGAGCAAGGGCTGGTGAAGCTGCTA
ACTTTTGTGCACTTATCTTAGCCTACTGTAATAAGACAGTAGGTGAGTTAGGTGATGTTAGAGAAACAAT
GAGTTACTTGTTTCAACATGCCAATTTAGATTCTTGCAAAAGAGTCTTGAACGTGGTGTGTAAAACTTGT
GGACAACAGCAGACAACCCTTAAGGGTGTAGAAGCTGTTATGTACATGGGCACACTTTCTTATGAACAAT
TTAAGAAAGGTGTTCAGATACCTTGTACGTGTGGTAAACAAGCTACAAAATATCTAGTACAACAGGAGTC
ACCTTTTGTTATGATGTCAGCACCACCTGCTCAGTATGAACTTAAGCATGGTACATTTACTTGTGCTAGT
GAGTACACTGGTAATTACCAGTGTGGTCACTATAAACATATAACTTCTAAAGAAACTTTGTATTGCATAG
ACGGTGCTTTACTTACAAAGTCCTCAGAATACAAAGGTCCTATTACGGATGTTTTCTACAAAGAAAACAG
TTACACAACAACCATAAAACCAGTTACTTATAAATTGGATGGTGTTGTTTGTACAGAAATTGACCCTAAG
TTGGACAATTATTATAAGAAAGACAATTCTTATTTCACAGAGCAACCAATTGATCTTGTACCAAACCAAC
CATATCCAAACGCAAGCTTCGATAATTTTAAGTTTGTATGTGATAATATCAAATTTGCTGATGATTTAAA
CCAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGGT
GATGTGGTGGCTATTGATTATAAACACTACACACCCTCTTTTAAGAAAGGAGCTAAATTGTTACATAAAC
CTATTGTTTGGCATGTTAACAATGCAACTAATAAAGCCACGTATAAACCAAATACCTGGTGTATACGTTG
TCTTTGGAGCACAAAACCAGTTGAAACATCAAATTCGTTTGATGTACTGAAGTCAGAGGACGCGCAGGGA
ATGGATAATCTTGCCTGCGAAGATCTAAAACCAGTCTCTGAAGAAGTAGTGGAAAATCCTACCATACAGA
AAGACGTTCTTGAGTGTAATGTGAAAACTACCGAAGTTGTAGGAGACATTATACTTAAACCAGCAAATAA
TAGTTTAAAAATTACAGAAGAGGTTGGCCACACAGATCTAATGGCTGCTTATGTAGACAATTCTAGTCTT
ACTATTAAGAAACCTAATGAATTATCTAGAGTATTAGGTTTGAAAACCCTTGCTACTCATGGTTTAGCTG
CTGTTAATAGTGTCCCTTGGGATACTATAGCTAATTATGCTAAGCCTTTTCTTAACAAAGTTGTTAGTAC
AACTACTAACATAGTTACACGGTGTTTAAACCGTGTTTGTACTAATTATATGCCTTATTTCTTTACTTTA
TTGCTACAATTGTGTACTTTTACTAGAAGTACAAATTCTAGAATTAAAGCATCTATGCCGACTACTATAG
CAAAGAATACTGTTAAGAGTGTCGGTAAATTTTGTCTAGAGGCTTCATTTAATTATTTGAAGTCACCTAA
TTTTTCTAAACTGATAAATATTATAATTTGGTTTTTACTATTAAGTGTTTGCCTAGGTTCTTTAATCTAC
TCAACCGCTGCTTTAGGTGTTTTAATGTCTAATTTAGGCATGCCTTCTTACTGTACTGGTTACAGAGAAG
GCTATTTGAACTCTACTAATGTCACTATTGCAACCTACTGTACTGGTTCTATACCTTGTAGTGTTTGTCT
TAGTGGTTTAGATTCTTTAGACACCTATCCTTCTTTAGAAACTATACAAATTACCATTTCATCTTTTAAA
TGGGATTTAACTGCTTTTGGCTTAGTTGCAGAGTGGTTTTTGGCATATATTCTTTTCACTAGGTTTTTCT
ATGTACTTGGATTGGCTGCAATCATGCAATTGTTTTTCAGCTATTTTGCAGTACATTTTATTAGTAATTC
TTGGCTTATGTGGTTAATAATTAATCTTGTACAAATGGCCCCGATTTCAGCTATGGTTAGAATGTACATC
TTCTTTGCATCATTTTATTATGTATGGAAAAGTTATGTGCATGTTGTAGACGGTTGTAATTCATCAACTT
GTATGATGTGTTACAAACGTAATAGAGCAACAAGAGTCGAATGTACAACTATTGTTAATGGTGTTAGAAG
GTCCTTTTATGTCTATGCTAATGGAGGTAAAGGCTTTTGCAAACTACACAATTGGAATTGTGTTAATTGT
GATACATTCTGTGCTGGTAGTACATTTATTAGTGATGAAGTTGCGAGAGACTTGTCACTACAGTTTAAAA
GACCAATAAATCCTACTGACCAGTCTTCTTACATCGTTGATAGTGTTACAGTGAAGAATGGTTCCATCCA
TCTTTACTTTGATAAAGCTGGTCAAAAGACTTATGAAAGACATTCTCTCTCTCATTTTGTTAACTTAGAC
AACCTGAGAGCTAATAACACTAAAGGTTCATTGCCTATTAATGTTATAGTTTTTGATGGTAAATCAAAAT
GTGAAGAATCATCTGCAAAATCAGCGTCTGTTTACTACAGTCAGCTTATGTGTCAACCTATACTGTTACT
AGATCAGGCATTAGTGTCTGATGTTGGTGATAGTGCGGAAGTTGCAGTTAAAATGTTTGATGCTTACGTT
AATACGTTTTCATCAACTTTTAACGTACCAATGGAAAAACTCAAAACACTAGTTGCAACTGCAGAAGCTG
AACTTGCAAAGAATGTGTCCTTAGACAATGTCTTATCTACTTTTATTTCAGCAGCTCGGCAAGGGTTTGT
TGATTCAGATGTAGAAACTAAAGATGTTGTTGAATGTCTTAAATTGTCACATCAATCTGACATAGAAGTT
ACTGGCGATAGTTGTAATAACTATATGCTCACCTATAACAAAGTTGAAAACATGACACCCCGTGACCTTG
GTGCTTGTATTGACTGTAGTGCGCGTCATATTAATGCGCAGGTAGCAAAAAGTCACAACATTGCTTTGAT
ATGGAACGTTAAAGATTTCATGTCATTGTCTGAACAACTACGAAAACAAATACGTAGTGCTGCTAAAAAG
AATAACTTACCTTTTAAGTTGACATGTGCAACTACTAGACAAGTTGTTAATGTTGTAACAACAAAGATAG
CACTTAAGGGTGGTAAAATTGTTAATAATTGGTTGAAGCAGTTAATTAAAGTTACACTTGTGTTCCTTTT
TGTTGCTGCTATTTTCTATTTAATAACACCTGTTCATGTCATGTCTAAACATACTGACTTTTCAAGTGAA
ATCATAGGATACAAGGCTATTGATGGTGGTGTCACTCGTGACATAGCATCTACAGATACTTGTTTTGCTA
ACAAACATGCTGATTTTGACACATGGTTTAGYCAGCGTGGTGGTAGTTATACTAATGACAAAGCTTGCCC
ATTGATTGCTGCAGTCATAACAAGAGAAGTGGGTTTTGTCGTGCCTGGTTTGCCTGGCACGATATTACGC
ACAACTAATGGTGACTTTTTGCATTTCTTACCTAGAGTTTTTAGTGCAGTTGGTAACATCTGTTACACAC
CATCAAAACTTATAGAGTACACTGACTTTGCAACATCAGCTTGTGTTTTGGCTGCTGAATGTACAATTTT
TAAAGATGCTTCTGGTAAGCCAGTACCATATTGTTATGATACCAATGTACTAGAAGGTTCTGTTGCTTAT
GAAAGTTTACGCCCTGACACACGTTATGTGCTCATGGATGGCTCTATTATTCAATTTCCTAACACCTACC
TTGAAGGTTCTGTTAGAGTGGTAACAACTTTTGATTCTGAGTACTGTAGGCACGGCACTTGTGAAAGATC
AGAAGCTGGTGTTTGTGTATCTACTAGTGGTAGATGGGTACTTAACAATGATTATTACAGATCTTTACCA
GGAGTTTTCTGTGGTGTAGATGCTGTAAATTTACTTACTAATATGTTTACACCACTAATTCAACCTATTG
GTGCTTTGGACATATCAGCATCTATAGTAGCTGGTGGTATTGTAGCTATCGTAGTAACATGCCTTGCCTA
CTATTTTATGAGGTTTAGAAGAGCTTTTGGTGAATACAGTCATGTAGTTGCCTTTAATACTTTACTATTC
CTTATGTCATTCACTGTACTCTGTTTAACACCAGTTTACTCATTCTTACCTGGTGTTTATTCTGTTATTT
ACTTGTACTTGACATTTTATCTTACTAATGATGTTTCTTTTTTAGCACATATTCAGTGGATGGTTATGTT
CACACCTTTAGTACCTTTCTGGATAACAATTGCTTATATCATTTGTATTTCCACAAAGCATTTCTATTGG
TTCTTTAGTAATTACCTAAAGAGACGTGTAGTCTTTAATGGTGTTTCCTTTAGTACTTTTGAAGAAGCTG
CGCTGTGCACCTTTTTGTTAAATAAAGAAATGTATCTAAAGTTGCGTAGTGATGTGCTATTACCTCTTAC
GCAATATAATAGATACTTAGCTCTTTATAATAAGTACAAGTATTTTAGTGGAGCAATGGATACAACTAGC
TACAGAGAAGCTGCTTGTTGTCATCTCGCAAAGGCTCTCAATGACTTCAGTAACTCAGGTTCTGATGTTC
TTTACCAACCACCACAAACCTCTATCACCTCAGCTGTTTTGCAGAGTGGTTTTAGAAAAATGGCATTCCC
ATCTGGTAAAGTTGAGGGTTGTATGGTACAAGTAACTTGTGGTACAACTACACTTAACGGTCTTTGGCTT
GATGACGTAGTTTACTGTCCAAGACATGTGATCTGCACCTCTGAAGACATGCTTAACCCTAATTATGAAG
ATTTACTCATTCGTAAGTCTAATCATAATTTCTTGGTACAGGCTGGTAATGTTCAACTCAGGGTTATTGG
ACATTCTATGCAAAATTGTGTACTTAAGCTTAAGGTTGATACAGCCAATCCTAAGACACCTAAGTATAAG
TTTGTTCGCATTCAACCAGGACAGACTTTTTCAGTGTTAGCTTGTTACAATGGTTCACCATCTGGTGTTT
ACCAATGTGCTATGAGGCCCAATTTCACTATTAAGGGTTCATTCCTTAATGGTTCATGTGGTAGTGTTGG
TTTTAACATAGATTATGACTGTGTCTCTTTTTGTTACATGCACCATATGGAATTACCAACTGGAGTTCAT
GCTGGCACAGACTTAGAAGGTAACTTTTATGGACCTTTTGTTGACAGGCAAACAGCACAAGCAGCTGGTA
CGGACACAACTATTACAGTTAATGTTTTAGCTTGGTTGTACGCTGCTGTTATAAATGGAGACAGGTGGTT
TCTCAATCGATTTACCACAACTCTTAATGACTTTAACCTTGTGGCTATGAAGTACAATTATGAACCTCTA
ACACAAGACCATGTTGACATACTAGGACCTCTTTCTGCTCAAACTGGAATTGCCGTTTTAGATATGTGTG
CTTCATTAAAAGAATTACTGCAAAATGGTATGAATGGACGTACCATATTGGGTAGTGCTTTATTAGAAGA
TGAATTTACACCTTTTGATGTTGTTAGACAATGCTCAGGTGTTACTTTCCAAAGTGCAGTGAAAAGAACA
ATCAAGGGTACACACCACTGGTTGTTACTCACAATTTTGACTTCACTTTTAGTTTTAGTCCAGAGTACTC
AATGGTCTTTGTTCTTTTTTTTGTATGAAAATGCCTTTTTACCTTTTGCTATGGGTATTATTGCTATGTC
TGCTTTTGCAATGATGTTTGTCAAACATAAGCATGCATTTCTCTGTTTGTTTTTGTTACCTTCTCTTGCC
ACTGTAGCTTATTTTAATATGGTCTATATGCCTGCTAGTTGGGTGATGCGTATTATGACATGGTTGGATA
TGGTTGATACTAGTTTGTCTGGTTTTAAGCTAAAAGACTGTGTTATGTATGCATCAGCTGTAGTGTTACT
AATCCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTG
ACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCT
CTGTTACTTCTAACTACTCAGGTGTAGTTACAACTGTCATGTTTTTGGCCAGAGGTATTGTTTTTATGTG
TGTTGAGTATTGCCCTATTTTCTTCATAACTGGTAATACACTTCAGTGTATAATGCTAGTTTATTGTTTC
TTAGGCTATTTTTGTACTTGTTACTTTGGCCTCTTTTGTTTACTCAACCGCTACTTTAGACTGACTCTTG
GTGTTTATGATTACTTAGTTTCTACACAGGAGTTTAGATATATGAATTCACAGGGACTACTCCCACCCAA
GAATAGCATAGATGCCTTCAAACTCAACATTAAATTGTTGGGTGTTGGTGGCAAACCTTGTATCAAAGTA
GCCACTGTACAGTCTAAAATGTCAGATGTAAAGTGCACATCAGTAGTCTTACTCTCAGTTTTGCAACAAC
TCAGAGTAGAATCATCATCTAAATTGTGGGCTCAATGTGTCCAGTTACACAATGACATTCTCTTAGCTAA
AGATACTACTGAAGCCTTTGAAAAAATGGTTTCACTACTTTCTGTTTTGCTTTCCATGCAGGGTGCTGTA
GACATAAACAAGCTTTGTGAAGAAATGCTGGACAACAGGGCAACCTTACAAGCTATAGCCTCAGAGTTTA
GTTCCCTTCCATCATATGCAGCTTTTGCTACTGCTCAAGAAGCTTATGAGCAGGCTGTTGCTAATGGTGA
TTCTGAAGTTGTTCTTAAAAAGTTGAAGAAGTCTTTGAATGTGGCTAAATCTGAATTTGACCGTGATGCA
GCCATGCAACGTAAGTTGGAAAAGATGGCTGATCAAGCTATGACCCAAATGTATAAACAGGCTAGATCTG
AGGACAAGAGGGCAAAAGTTACTAGTGCTATGCAGACAATGCTTTTCACTATGCTTAGAAAGTTGGATAA
TGATGCACTCAACAACATTATCAACAATGCAAGAGATGGTTGTGTTCCCTTGAACATAATACCTCTTACA
ACAGCAGCCAAACTAATGGTTGTCATACCAGACTATAACACATATAAAAATACGTGTGATGGTACAACAT
TTACTTATGCATCAGCATTGTGGGAAATCCAACAGGTTGTAGATGCAGATAGTAAAATTGTTCAACTTAG
TGAAATTAGTATGGACAATTCACCTAATTTAGCATGGCCTCTTATTGTAACAGCTTTAAGGGCCAATTCT
GCTGTCAAATTACAGAATAATGAGCTTAGTCCTGTTGCACTACGACAGATGTCTTGTGCTGCCGGTACTA
CACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACTACAACACAACAAAGGGAGGTAGGTTTGTACT
TGCACTGTTATCCGATTTACAGGATTTGAAATGGGCTAGATTCCCTAAGAGTGATGGAACTGGTACTATC
TATACAGAACTGGAACCACCTTGTAGGTTTGTTACAGACACACCTAAAGGTCCTAAAGTGAAGTATTTAT
ACTTTATTAAAGGATTAAACAACCTAAATAGAGGTATGGTACTTGGTAGTTTAGCTGCCACAGTACGTCT
ACAAGCTGGTAATGCAACAGAAGTGCCTGCCAATTCAACTGTATTATCTTTCTGTGCTTTTGCTGTAGAT
GCTGCTAAAGCTTACAAAGATTATCTAGCTAGTGGGGGACAACCAATCACTAATTGTGTTAAGATGTTGT
GTACACACACTGGTACTGGTCAGGCAATAACAGTTACACCGGAAGCCAATATGGATCAAGAATCCTTTGG
TGGTGCATCGTGTTGTCTGTACTGCCGTTGCCACATAGATCATCCAAATCCTAAAGGATTTTGTGACTTA
AAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTTTACACTTAAAAACACAG
TCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCA
GTCAGCTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCA
CAGGCACTAGTACTGATGTCGTATACAGGGCTTTTGACATCTACAATGATAAAGTAGCTGGTTTTGCTAA
ATTCCTAAAAACTAATTGTTGTCGCTTCCAAGAAAAGGACGAAGATGACAATTTAATTGATTCTTACTTT
GTAGTTAAGAGACACACTTTCTCTAACTACCAACATGAAGAAACAATTTATAATTTACTTAAGGATTGTC
CAGCTGTTGCTAAACATGACTTCTTTAAGTTTAGAATAGACGGTGACATGGTACCACATATATCACGTCA
ACGTCTTACTAAATACACAATGGCAGACCTCGTCTATGCTTTAAGGCATTTTGATGAAGGTAATTGTGAC
ACATTAAAAGAAATACTTGTCACATACAATTGTTGTGATGATGATTATTTCAATAAAAAGGACTGGTATG
ATTTTGTAGAAAACCCAGATATATTACGCGTATACGCCAACTTAGGTGAACGTGTACGCCAAGCTTTGTT
AAAAACAGTACAATTCTGTGATGCCATGCGAAATGCTGGTATTGTTGGTGTACTGACATTAGATAATCAA
GATCTCAATGGTAACTGGTATGATTTCGGTGATTTCATACAAACCACGCCAGGTAGTGGAGTTCCTGTTG
TAGATTCTTATTATTCATTGTTAATGCCTATATTAACCTTGACCAGGGCTTTAACTGCAGAGTCACATGT
TGACACTGACTTAACAAAGCCTTACATTAAGTGGGATTTGTTAAAATATGACTTCACGGAAGAGAGGTTA
AAACTCTTTGACCGTTATTTTAAATATTGGGATCAGACATACCACCCAAATTGTGTTAACTGTTTGGATG
ACAGATGCATTCTGCATTGTGCAAACTTTAATGTTTTATTCTCTACAGTGTTCCCACCTACAAGTTTTGG
ACCACTAGTGAGAAAAATATTTGTTGATGGTGTTCCATTTGTAGTTTCAACTGGATACCACTTCAGAGAG
CTAGGTGTTGTACATAATCAGGATGTAAACTTACATAGCTCTAGACTTAGTTTTAAGGAATTACTTGTGT
ATGCTGCTGACCCTGCTATGCACGCTGCTTCTGGTAATCTATTACTAGATAAACGCACTACGTGCTTTTC
AGTAGCTGCACTTACTAACAATGTTGCTTTTCAAACTGTCAAACCCGGTAATTTTAACAAAGACTTCTAT
GACTTTGCTGTGTCTAAGGGTTTCTTTAAGGAAGGAAGTTCTGTTGAATTAAAACACTTCTTCTTTGCTC
AGGATGGTAATGCTGCTATCAGCGATTATGACTACTATCGTTATAATCTACCAACAATGTGTGATATCAG
ACAACTACTATTTGTAGTTGAAGTTGTTGATAAGTACTTTGATTGTTACGATGGTGGCTGTATTAATGCT
AACCAAGTCATCGTCAACAACCTAGACAAATCAGCTGGTTTTCCATTTAATAAATGGGGTAAGGCTAGAC
TTTATTATGATTCAATGAGTTATGAGGATCAAGATGCACTTTTCGCATATACAAAACGTAATGTCATCCC
TACTATAACTCAAATGAATCTTAAGTATGCCATTAGTGCAAAGAATAGAGCTCGCACCGTAGCTGGTGTC
TCTATCTGTAGTACTATGACCAATAGACAGTTTCATCAAAAATTATTGAAATCAATAGCCGCCACTAGAG
GAGCTACTGTAGTAATTGGAACAAGCAAATTCTATGGTGGTTGGCACAACATGTTAAAAACTGTTTATAG
TGATGTAGAAAACCCTCACCTTATGGGTTGGGATTATCCTAAATGTGATAGAGCCATGCCTAACATGCTT
AGAATTATGGCCTCACTTGTTCTTGCTCGCAAACATACAACGTGTTGTAGCTTGTCACACCGTTTCTATA
GATTAGCTAATGAGTGTGCTCAAGTATTGAGTGAAATGGTCATGTGTGGCGGTTCACTATATGTTAAACC
AGGTGGAACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGTGTTTTTAACATTTGTCAAGCTGTC
ACGGCCAATGTTAATGCACTTTTATCTACTGATGGTAACAAAATTGCCGATAAGTATGTCCGCAATTTAC
AACACAGACTTTATGAGTGTCTCTATAGAAATAGAGATGTTGACACAGACTTTGTGAATGAGTTTTACGC
ATATTTGCGTAAACATTTCTCAATGATGATACTCTCTGACGATGCTGTTGTGTGTTTCAATAGCACTTAT
GCATCTCAAGGTCTAGTGGCTAGCATAAAGAACTTTAAGTCAGTTCTTTATTATCAAAACAATGTTTTTA
TGTCTGAAGCAAAATGTTGGACTGAGACTGACCTTACTAAAGGACCTCATGAATTTTGCTCTCAACATAC
AATGCTAGTTAAACAGGGTGATGATTATGTGTACCTTCCTTACCCAGATCCATCAAGAATCCTAGGGGCC
GGCTGTTTTGTAGATGATATCGTAAAAACAGATGGTACACTTATGATTGAACGGTTCGTGTCTTTAGCTA
TAGATGCTTACCCACTTACTAAACATCCTAATCAGGAGTATGCTGATGTCTTTCATTTGTACTTACAATA
CATAAGAAAGCTACATGATGAGTTAACAGGACACATGTTAGACATGTATTCTGTTATGCTTACTAATGAT
AACACTTCAAGGTATTGGGAACCTGAGTTTTATGAGGCTATGTACACACCGCATACAGTCTTACAGGCTG
TTGGGGCTTGTGTTCTTTGCAATTCACAGACTTCATTAAGATGTGGTGCTTGCATACGTAGACCATTCTT
ATGTTGTAAATGCTGTTACGACCATGTCATATCAACATCACATAAATTAGTCTTGTCTGTTAATCCGTAT
GTTTGCAATGCTCCAGGTTGTGATGTCACAGATGTGACTCAACTTTACTTAGGAGGTATGAGCTATTATT
GTAAATCACATAAACCACCCATTAGTTTTCCATTGTGTGCTAATGGACAAGTTTTTGGTTTATATAAAAA
TACATGTGTTGGTAGCGATAATGTTACTGACTTTAATGCAATTGCAACATGTGACTGGACAAATGCTGGT
GATTACATTTTAGCTAACACCTGTACTGAAAGACTCAAGCTTTTTGCAGCAGAAACGCTCAAAGCTACTG
AGGAGACATTTAAACTGTCTTATGGTATTGCTACTGTACGTGAAGTGCTGTCTGACAGAGAATTACATCT
TTCATGGGAAGTTGGTAAACCTAGACCACCACTTAACCGAAATTATGTCTTTACTGGTTATCGTGTAACT
AAAAACAGTAAAGTACAAATAGGAGAGTACACCTTTGAAAAAGGTGACTATGGTGATGCTGTTGTTTACC
GAGGTACAACAACTTACAAATTAAATGTTGGTGATTATTTTGTGCTGACATCACATACAGTAATGCCATT
AAGTGCACCTACACTAGTGCCACAAGAGCACTATGTTAGAATTACTGGCTTATACCCAACACTCAATATC
TCAGATGAGTTTTCTAGCAATGTTGCAAATTATCAAAAGGTTGGTATGCAAAAGTATTCTACACTCCAGG
GACCACCTGGTACTGGTAAGAGTCATTTTGCTATTGGCCTAGCTCTCTACTACCCTTCTGCTCGCATAGT
GTATACAGCTTGCTCTCATGCCGCTGTTGATGCACTATGTGAGAAGGCATTAAAATATTTGCCTATAGAT
AAATGTAGTAGAATTATACCTGCACGTGCTCGTGTAGAGTGTTTTGATAAATTCAAAGTGAATTCAACAT
TAGAACAGTATGTCTTTTGTACTGTAAATGCATTGCCTGAGACGACAGCAGATATAGTTGTCTTTGATGA
AATTTCAATGGCCACAAATTATGATTTGAGTGTTGTCAATGCCAGATTACGTGCTAAGCACTATGTGTAC
ATTGGCGACCCTGCTCAATTACCTGCACCACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATT
TCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCC
TGCTGAAATTGTTGACACTGTGAGTGCTTTGGTTTATGATAATAAGCTTAAAGCACATAAAGACAAATCA
GCTCAATGCTTTAAAATGTTTTATAAGGGTGTTATCACGCATGATGTTTCATCTGCAATTAACAGGCCAC
AAATAGGCGTGGTAAGAGAATTCCTTACACGTAACCCTGCTTGGAGAAAAGCTGTCTTTATTTCACCTTA
TAATTCACAGAATGCTGTAGCCTCAAAGATTTTGGGACTACCAACTCAAACTGTTGATTCATCACAGGGC
TCAGAATATGACTATGTCATATTCACTCAAACCACTGAAACAGCTCACTCTTGTAATGTAAACAGATTTA
ATGTTGCTATTACCAGAGCAAAAGTAGGCATACTTTGCATAATGTCTGATAGAGACCTTTATGACAAGTT
GCAATTTACAAGTCTTGAAATTCCACGTAGGAATGTGGCAACTTTACAAGCTGAAAATGTAACAGGACTC
TTTAAAGATTGTAGTAAGGTAATCACTGGGTTACATCCTACACAGGCACCTACACACCTCAGTGTTGACA
CTAAATTCAAAACTGAAGGTTTATGTGTTGACATACCTGGCATACCTAAGGACATGACCTATAGAAGACT
CATCTCTATGATGGGTTTTAAAATGAATTATCAAGTTAATGGTTACCCTAACATGTTTATCACCCGCGAA
GAAGCTATAAGACATGTACGTGCATGGATTGGCTTCGATGTCGAGGGGTGTCATGCTACTAGAGAAGCTG
TTGGTACCAATTTACCTTTACAGCTAGGTTTTTCTACAGGTGTTAACCTAGTTGCTGTACCTACAGGTTA
TGTTGATACACCTAATAATACAGATTTTTCCAGAGTTAGTGCTAAACCACCGCCTGGAGATCAATTTAAA
CACCTCATACCACTTATGTACAAAGGACTTCCTTGGAATGTAGTGCGTATAAAGATTGTACAAATGTTAA
GTGACACACTTAAAAATCTCTCTGACAGAGTCGTATTTGTCTTATGGGCACATGGCTTTGAGTTGACATC
TATGAAGTATTTTGTGAAAATAGGACCTGAGCGCACCTGTTGTCTATGTGATAGACGTGCCACATGCTTT
TCCACTGCTTCAGACACTTATGCCTGTTGGCATCATTCTATTGGATTTGATTACGTCTATAATCCGTTTA
TGATTGATGTTCAACAATGGGGTTTTACAGGTAACCTACAAAGCAACCATGATCTGTATTGTCAAGTCCA
TGGTAATGCACATGTAGCTAGTTGTGATGCAATCATGACTAGGTGTCTAGCTGTCCACGAGTGCTTTGTT
AAGCGTGTTGACTGGACTATTGAATATCCTATAATTGGTGATGAACTGAAGATTAATGCGGCTTGTAGAA
AGGTTCAACACATGGTTGTTAAAGCTGCATTATTAGCAGACAAATTCCCAGTTCTTCACGACATTGGTAA
CCCTAAAGCTATTAAGTGTGTACCTCAAGCTGATGTAGAATGGAAGTTCTATGATGCACAGCCTTGTAGT
GACAAAGCTTATAAAATAGAAGAATTATTCTATTCTTATGCCACACATTCTGACAAATTCACAGATGGTG
TATGCCTATTTTGGAATTGCAATGTCGATAGATATCCTGCTAATTCCATTGTTTGTAGATTTGACACTAG
AGTGCTATCTAACCTTAACTTGCCTGGTTGTGATGGTGGCAGTTTGTATGTAAATAAACATGCATTCCAC
ACACCAGCTTTTGATAAAAGTGCTTTTGTTAATTTAAAACAATTACCATTTTTCTATTACTCTGACAGTC
CATGTGAGTCTCATGGAAAACAAGTAGTGTCAGATATAGATTATGTACCACTAAAGTCTGCTACGTGTAT
AACACGTTGCAATTTAGGTGGTGCTGTCTGTAGACATCATGCTAATGAGTACAGATTGTATCTCGATGCT
TATAACATGATGATCTCAGCTGGCTTTAGCTTGTGGGTTTACAAACAATTTGATACTTATAACCTCTGGA
ACACTTTTACAAGACTTCAGAGTTTAGAAAATGTGGCTTTTAATGTTGTAAATAAGGGACACTTTGATGG
ACAACAGGGTGAAGTACCAGTTTCTATCATTAATAACACTGTTTACACAAAAGTTGATGGTGTTGATGTA
GAATTGTTTGAAAATAAAACAACATTACCTGTTAATGTAGCATTTGAGCTTTGGGCTAAGCGCAACATTA
AACCAGTACCAGAGGTGAAAATACTCAATAATTTGGGTGTGGACATTGCTGCTAATACTGTGATCTGGGA
CTACAAAAGAGATGCTCCAGCACATATATCTACTATTGGTGTTTGTTCTATGACTGACATAGCCAAGAAA
CCAACTGAAACGATTTGTGCACCACTCACTGTCTTTTTTGATGGTAGAGTTGATGGTCAAGTAGACTTAT
TTAGAAATGCCCGTAATGGTGTTCTTATTACAGAAGGTAGTGTTAAAGGTTTACAACCATCTGTAGGTCC
CAAACAAGCTAGTCTTAATGGAGTCACATTAATTGGAGAAGCCGTAAAAACACAGTTCAATTATTATAAG
AAAGTTGATGGTGTTGTCCAACAATTACCTGAAACTTACTTTACTCAGAGTAGAAATTTACAAGAATTTA
AACCCAGGAGTCAAATGGAAATTGATTTCTTAGAATTAGCTATGGATGAATTCATTGAACGGTATAAATT
AGAAGGCTATGCCTTCGAACATATCGTTTATGGAGATTTTAGTCATAGTCAGTTAGGTGGTTTACATCTA
CTGATTGGACTAGCTAAACGTTTTAAGGAATCACCTTTTGAATTAGAAGATTTTATTCCTATGGACAGTA
CAGTTAAAAACTATTTCATAACAGATGCGCAAACAGGTTCATCTAAGTGTGTGTGTTCTGTTATTGATTT
ATTACTTGATGATTTTGTTGAAATAATAAAATCCCAAGATTTATCTGTAGTTTCTAAGGTTGTCAAAGTG
ACTATTGACTATACAGAAATTTCATTTATGCTTTGGTGTAAAGATGGCCATGTAGAAACATTTTACCCAA
AATTACAATCTAGTCAAGCGTGGCAACCGGGTGTTGCTATGCCTAATCTTTACAAAATGCAAAGAATGCT
ATTAGAAAAGTGTGACCTTCAAAATTATGGTGATAGTGCAACATTACCTAAAGGCATAATGATGAATGTC
GCAAAATATACTCAACTGTGTCAATATTTAAACACATTAACATTAGCTGTACCCTATAATATGAGAGTTA
TACATTTTGGTGCTGGTTCTGATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAGACAGTGGTTGCCTAC
GGGTACGCTGCTTGTCGATTCAGATCTTAATGACTTTGTCTCTGATGCAGATTCAACTTTGATTGGTGAT
TGTGCAACTGTACATACAGCTAATAAATGGGATCTCATTATTAGTGATATGTACGACCCTAAGACTAAAA
ATGTTACAAAAGAAAATGACTCTAAAGAGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCT
AGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATG
GGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTG
GATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTG
GAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTA
AGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAG
GTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAA
CAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCA
ATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCA
GTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATG
TCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGC
TTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCC
CTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCAT
TTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGC
GAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATTTC
AAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTA
TTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGTAT
TAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCA
GGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATA
ATGAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAGTGTACGTT
GAAATCCTTCACTGTAGAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTCCAACCAACAGAATCTATT
GTTAGATTTCCTAATATTACAAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTG
TTTATGCTTGGAACAGGAAGAGAATCAGCAACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATC
ATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTAT
GCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTG
ATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTC
TAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGA
GATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACT
TTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACT
TTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAAC
AAATGTGTCAATTTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTC
TGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTACTGATGCTGTCCGTGATCCACAGACACTTGA
GATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACACCAGGAACAAATACTTCTAAC
CAGGTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTA
CTCCTACTTGGCGTGTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGC
TGAACATGTCAACAACTCATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACT
CAGACTAATTCTCCTCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTG
GTGCAGAAAATTCAGTTGCTTACTCTAATAACTCTATTGCCATACCCACAAATTTTACTATTAGTGTTAC
CACAGAAATTCTACCAGTGTCTATGACCAAGACATCAGTAGATTGTACAATGTACATTTGTGGTGATTCA
ACTGAATGCAGCAATCTTTTGTTGCAATATGGCAGTTTTTGTACACAATTAAACCGTGCTTTAACTGGAA
TAGCTGTTGAACAAGACAAAAACACCCAAGAAGTTTTTGCACAAGTCAAACAAATTTACAAAACACCACC
AATTAAAGATTTTGGTGGTTTTAATTTTTCACAAATATTACCAGATCCATCAAAACCAAGCAAGAGGTCA
TTTATTGAAGATCTACTTTTCAAYAAAGTGACACTTGCAGATGCTGGCTTCATCAAACAATATGGTGATT
GCCTTGGTGATATTGCTGCTAGAGACCTCATTTGTGCACAAAAGTTTAACGGCCTTACTGTTTTGCCACC
TTTGCTCACAGATGAAATGATTGCTCAATACACTTCTGCACTGTTAGCGGGTACAATCACTTCTGGTTGG
ACCTTTGGTGCAGGTGCTGCATTACAAATACCATTTGCTATGCAAATGGCTTATAGGTTTAATGGTATTG
GAGTTACACAGAATGTTCTCTATGAGAACCAAAAATTGATTGCCAACCAATTTAATAGTGCTATTGGCAA
AATTCAAGACTCACTTTCTTCCACAGCAAGTGCACTTGGAAAACTTCAAGATGTGGTCAACCAAAATGCA
CAAGCTTTAAACACGCTTGTTAAACAACTTAGCTCCAATTTTGGTGCAATTTCAAGTGTTTTAAATGATA
TCCTTTCACGTCTTGACAAAGTTGAGGCTGAAGTGCAAATTGATAGGTTGATCACAGGCAGACTTCAAAG
TTTGCAGACATATGTGACTCAACAATTAATTAGAGCTGCAGAAATCAGAGCTTCTGCTAATCTTGCTGCT
ACTAAAATGTCAGAGTGTGTACTTGGACAATCAAAAAGAGTTGATTTTTGTGGAAAGGGCTATCATCTTA
TGTCCTTCCCTCAGTCAGCACCTCATGGTGTAGTCTTCTTGCATGTGACTTATGTCCCTGCACAAGAAAA
GAACTTCACAACTGCTCCTGCCATTTGTCATGATGGAAAAGCACACTTTCCTCGTGAAGGTGTCTTTGTT
TCAAATGGCACACACTGGTTTGTAACACAAAGGAATTTTTATGAACCACAAATCATTACTACAGACAACA
CATTTGTGTCTGGTAACTGTGATGTTGTAATAGGAATTGTCAACAACACAGTTTATGATCCTTTGCAACC
TGAATTAGACTCATTCAAGGAGGAGTTAGATAAATATTTTAAGAATCATACATCACCAGATGTTGATTTA
GGTGACATCTCTGGCATTAATGCTTCAGTTGTAAACATTCAAAAAGAAATTGACCGCCTCAATGAGGTTG
CCAAGAATTTAAATGAATCTCTCATCGATCTCCAAGAACTTGGAAAGTATGAGCAGTATATAAAATGGCC
ATGGTACATTTGGCTAGGTTTTATAGCTGGCTTGATTGCCATAGTAATGGTGACAATTATGCTTTGCTGT
ATGACCAGTTGCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACG
ACTCTGAGCCAGTGCTCAAAGGAGTCAAATTACATTACACATAAACGAACTTATGGATTTGTTTATGAGA
ATCTTCACAATTGGAACTGTAACTTTGAAGCAAGGTGAAATCAAGGATGCTACTCCTTCAGATTTTGTTC
GCGCTACTGCAACGATACCGATACAAGCCTCACTCCCTTTCGGATGGCTTATTGTTGGCGTTGCACTTCT
TGCTGTTTTTCAGAGCGCTTCCAAAATCATAACCCTCAAAAAGAGATGGCAACTAGCACTCTCCAAGGGT
GTTCACTTTGTTTGCAACTTGCTGTTGTTGTTTGTAACAGTTTACTCACACCTTTTGCTCGTTGCTGCTG
GCCTTGAAGCCCCTTTTCTCTATCTTTATGCTTTAGTCTACTTCTTGCAGAGTATAAACTTTGTAAGAAT
AATAATGAGGCTTTGGCTTTGCTGGAAATGCCGTTCCAAAAACCCATTACTTTATGATGCCAACTATTTT
CTTTGCTGGCATACTAATTGTTACGACTATTGTATACCTTACAATAGTGTAACTTCTTCAATTGTCATTA
CTTCAGGTGATGGCACAACAAGTCCTATTTCTGAACATGACTACCAGATTGGTGGTTATACTGAAAAATG
GGAATCTGGAGTAAAAGACTGTGTTGTATTACACAGTTACTTCACTTCAGACTATTACCAGCTGTACTCA
ACTCAATTGAGTACAGACACTGGTGTTGAACATGTTACCTTCTTCATCTACAATAAAATTGTTGATGAGC
CTGAAGAACATGTCCAAATTCACACAATCGACGGTTCATCCGGAGTTGTTAATCCAGTAATGGAACCAAT
TTATGATGAACCGACGACGACTACTAGCGTGCCTTTGTAAGCACAAGCTGATGAGTACGAACTTATGTAC
TCATTCGTTTCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTAT
TCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGT
GAGTCTTGTAAAACCTTCTTTTTACGTTTACTCTCGTGTTAAAAATCTGAATTCTTCTAGAGTTCCTGAT
CTTCTGGTCTAAACGAACTAAATATTATATTAGTTTTTCTGTTTGGAACTTTAATTTTAGCCATGGCAGA
TTCCAACGGTACTATTACCGTTGAAGAGCTTAAAAAGCTCCTTGAACAATGGAACCTAGTAATAGGTTTC
CTATTCCTTACATGGATTTGTCTTCTACAATTTGCCTATGCCAACAGGAATAGGTTTTTGTATATAATTA
AGTTAATTTTCCTCTGGCTGTTATGGCCAGTAACTTTAGCTTGTTTTGTGCTTGCTGCYGTTTACAGAAT
AAATTGGATCACCGGTGGAATTGCTATCGCAATGGCTTGTCTTGTAGGCTTGATGTGGCTCAGCTACTTC
ATTGCTTCTTTCAGACTGTTTGCGCGTACGCGTTCCATGTGGTCATTCAATCCAGAAACTAACATTCTTC
TCAACGTGCCACTCCATGGCACTATTCTGACCAGACCGCTTCTAGAAAGTGAACTCGTAATCGGAGCTGT
GATCCTTCGTGGACATCTTCGTATTGCTGGACACCATCTAGGACGCTGTGACATCAAGGACCTGCCTAAA
GAAATCACTGTTGCTACATCACGAACGCTTTCTTATTACAAATTGGGAGCTTCGCAGCGTGTAGCAGGTG
ACTCAGGTTTTGCTGCATACAGTCGCTACAGGATTGGCAACTATAAATTAAACACAGACCATTCCAGTAG
CAGTGACAATATTGCTTTGCTTGTACAGTAAGTGACAACAGATGTTTCATCTCGTTGACTTTCAGGTTAC
TATAGCAGAGATATTACTAATTATTATGAGGACTTTTAAAGTTTCCATTTGGAATCTTGATTACATCATA
AACCTCATAATTAAAAATTTATCTAAGTCACTAACTGAGAATAAATATTCTCAATTAGATGAAGAGCAAC
CAATGGAGATTGATTAAACGAACATGAAAATTATTCTTTTCTTGGCACTGATAACACTCGCTACTTGTGA
GCTTTATCACTACCAAGAGTGTGTTAGAGGTACAACAGTACTTTTAAAAGAACCTTGCTCTTCTGGAACA
TACGAGGGCAATTCACCATTTCATCCTCTAGCTGATAACAAATTTGCACTGACTTGCTTTAGCACTCAAT
TTGCTTTTGCTTGTCCTGACGGCGTAAAACACGTCTATCAGTTACGTGCCAGATCAGTTTCACCTAAACT
GTTCATCAGACAAGAGGAAGTTCAAGAACTTTACTCTCCAATTTTTCTTATTGTTGCGGCAATAGTGTTT
ATAACACTTTGCTTCACACTCAAAAGAAAGACAGAATGATTGAACTTTCATTAATTGACTTCTATTTGTG
CTTTTTAGCCTTTCTGCTATTCCTTGTTTTAATTATGCTTATTATCTTTTGGTTCTCACTTGAACTGCAA
GATCATAATGAAACTTGTCACGCCTAAACGAACATGAAATTTCTTGTTTTCTTAGGAATCATCACAACTG
TAGCTGCATTTCACCAAGAATGTAGTTTACAGTCATGTACTCAACATCAACCATATGTAGTTGATGACCC
GTGTCCTATTCACTTCTATTCTAAATGGTATATTAGAGTAGGAGCTAGAAAATCAGCACCTTTAATTGAA
TTGTGCSTGGATGAGGCTGGTTCTAAATCACCCATTCAGTACATCGATATCGGTAATTATACAGTTTCCT
GTTYACCTTTTACAATTAATTGCCAGGAACCTAAATTGGGTAGTCTTGTAGTGCGTTGTTCGTTCTATGA
AGACTTTTTAGAGTATCATGACGTTCGTGTTGTTTTAGATTTCATCTAAACGAACAAACTAAAATGTCTG
ATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAG
TAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGGTTTACCCAATAATACT
GCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGACAAGGCGTTC
CAATTAACACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGG
TGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCT
GGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAA
AAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAAC
ATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGT
AGTCGCAACAGTTYAAGAAATTCAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCA
ATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGG
TAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGG
CAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCC
AAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACA
ATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACG
TGGTTGACCTACACAGGTGCCATCAAATTGGATGACAAAGATCCAAATTTCAAAGATCAAGTCATTTTGC
TGAATAAGCATATTGACGCATACAAAACATTCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAGAAGGC
TGATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAGCAAACTGTGACTCTTCTTCCTGCTGCAGAT
TTGGATGATTTCTCCAAACAATTGCAACAATCCATGAGCAGTGCTGACTCAACTCAGGCCTAAACTCATG
CAGACCACACAAGGCAGATGGGCTATATAAACGTTTTCGCTTTTCCGTTTACGATATATAGTCTACTCTT
GTGCAGAATGAATTCTCGTAACTACATAGCACAAGTAGATGTAGTTAACTTTAATCTCACATAGCAATCT
TTAATCAGTGTGTAACATTAGGGAGGACTTGAAAGAGCCACCACATTTTCACCGAGGCCACGCGGAGTAC
GATCGAGTGTACAGTGAACAATGCTAGGGAGAGCTGCCTATATGGAAGAGCCCTAATGTGTAAAATTAAT
TTTAGTAGTGCTATCCCCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAA

Veamos las diferencias entre COVID-19 (MN988713.1) y el virus encontrado en murcielagos, bat-SL-CoVZC45

El script está aquí.

$ sh genome_diff.sh MG772933.1 MN988713.1

MG772933.1: 29802 palabras  26618 89% comunes  856 3% borradas  2328 8% cambiadas
MN988713.1: 29882 palabras  26618 89% comunes  897 3% insertadas  2367 8% cambiadas --> Covid19

La única conclusión a la que me atrevo a llegar es que efectivamente parece haber un origen común entre el virus encontrado
en los murcielagos con respecto a la variante encontrada en Wuhan.

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )

Connecting to %s